Incidental Mutation 'P4717OSA:Olig1'
ID44010
Institutional Source Beutler Lab
Gene Symbol Olig1
Ensembl Gene ENSMUSG00000046160
Gene Nameoligodendrocyte transcription factor 1
SynonymsbHLHe21, Olg-1, Bhlhb6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location91269772-91271933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91269989 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 38 (Y38F)
Ref Sequence ENSEMBL: ENSMUSP00000061408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056882]
Predicted Effect probably damaging
Transcript: ENSMUST00000056882
AA Change: Y38F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061408
Gene: ENSMUSG00000046160
AA Change: Y38F

DomainStartEndE-ValueType
low complexity region 88 94 N/A INTRINSIC
HLH 100 159 2.75e-12 SMART
low complexity region 160 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232580
Meta Mutation Damage Score 0.1287 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired maturation of oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Olig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02390:Olig1 APN 16 91270153 missense probably damaging 0.98
R0368:Olig1 UTSW 16 91270652 missense probably damaging 0.99
Z1177:Olig1 UTSW 16 91270222 missense probably damaging 1.00
Z1177:Olig1 UTSW 16 91270471 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCAAGCCGGGTTTAAAGGTGTCAG -3'
(R):5'- AGTAGGGTAGGATAACTTCGCGCAG -3'

Sequencing Primer
(F):5'- GAGGGCGATCTGCCGAC -3'
(R):5'- GCCAAGTTCAGGTCCTGC -3'
Posted On2013-05-31