Incidental Mutation 'R5512:Gmip'
ID440104
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene NameGem-interacting protein
Synonyms5031419I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5512 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69808679-69821870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69817890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 750 (V750E)
Ref Sequence ENSEMBL: ENSMUSP00000116542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034325] [ENSMUST00000036074] [ENSMUST00000123453] [ENSMUST00000164890]
Predicted Effect probably benign
Transcript: ENSMUST00000034325
SMART Domains Protein: ENSMUSP00000034325
Gene: ENSMUSG00000031861

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 307 8.1e-10 PFAM
Pfam:7tm_1 46 292 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036074
AA Change: V750E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: V750E

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123453
AA Change: V750E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: V750E

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138269
Predicted Effect unknown
Transcript: ENSMUST00000142659
AA Change: V21E
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246
AA Change: V21E

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154903
Predicted Effect probably benign
Transcript: ENSMUST00000164890
SMART Domains Protein: ENSMUSP00000128261
Gene: ENSMUSG00000031861

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 307 8.1e-10 PFAM
Pfam:7tm_1 46 292 1.1e-32 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,350,660 V364A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Adgre5 T C 8: 83,729,086 N198D probably benign Het
Adgrf4 G T 17: 42,667,285 T389K probably benign Het
Apc T A 18: 34,310,909 probably benign Het
Appl2 T A 10: 83,605,818 I524F probably damaging Het
Arhgef37 G A 18: 61,499,774 Q531* probably null Het
Atp7b T C 8: 22,012,739 T694A probably benign Het
Cacna1g T A 11: 94,444,142 I780F probably damaging Het
Calcoco2 T C 11: 96,103,336 K95E probably damaging Het
Cars T C 7: 143,570,133 D388G possibly damaging Het
Ccdc150 A C 1: 54,354,647 E690A probably damaging Het
Cdc73 G T 1: 143,702,616 D3E probably damaging Het
Cdh23 C A 10: 60,534,386 probably null Het
Cep170b T C 12: 112,733,485 S143P possibly damaging Het
Cherp T C 8: 72,463,266 I607V possibly damaging Het
CN725425 T A 15: 91,240,756 H166Q probably benign Het
Dcaf6 A G 1: 165,399,835 V241A possibly damaging Het
Dot1l C T 10: 80,788,991 P881S possibly damaging Het
Dsg1c A T 18: 20,272,511 N327I probably damaging Het
Fam208b A T 13: 3,595,517 Y111N probably damaging Het
Fbxw7 G A 3: 84,954,909 R182H probably damaging Het
Fkbp1b A T 12: 4,838,183 V24E probably benign Het
Fut11 T C 14: 20,696,001 S304P probably damaging Het
Ggt1 C T 10: 75,584,884 T361I probably damaging Het
Gimap7 G T 6: 48,723,596 A39S probably benign Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm17541 G T 12: 4,689,452 probably benign Het
Gna14 A G 19: 16,608,128 E290G probably benign Het
Gpnmb T C 6: 49,045,464 V176A possibly damaging Het
Hhla1 T C 15: 65,924,016 K447R probably benign Het
Hsd3b1 A G 3: 98,853,205 Y157H probably benign Het
Iqgap2 G A 13: 95,675,376 Q706* probably null Het
Krt222 A C 11: 99,234,955 S283R probably damaging Het
Ldb2 G A 5: 44,480,244 R241W probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Masp2 A T 4: 148,614,069 I536F probably damaging Het
Mptx1 A G 1: 174,332,749 D207G probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Napsa A G 7: 44,572,616 M1V probably null Het
Ncam1 A T 9: 49,509,699 probably null Het
Nckap5 G A 1: 126,027,744 P425L possibly damaging Het
Nol8 A G 13: 49,676,787 S1116G probably benign Het
Nrde2 G T 12: 100,142,250 Q361K probably benign Het
Nudt13 G A 14: 20,307,732 G133D probably damaging Het
Ofcc1 G T 13: 40,206,810 Q248K probably benign Het
Olfm4 A G 14: 80,021,347 D345G probably benign Het
Olfr1287 G A 2: 111,449,754 V205I probably benign Het
Olfr720 C A 14: 14,175,633 G150C probably damaging Het
Osbpl3 T G 6: 50,309,360 K659N probably damaging Het
Pdk2 G A 11: 95,039,466 T48M probably damaging Het
Phf11a A T 14: 59,287,550 D68E probably benign Het
Prrxl1 A G 14: 32,600,044 H5R probably damaging Het
Purb A G 11: 6,475,702 V62A probably damaging Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rtl1 C T 12: 109,591,371 E1345K unknown Het
Sema3e G A 5: 14,230,180 A358T probably damaging Het
Slc29a2 A G 19: 5,026,398 I105V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc6a5 G A 7: 49,941,825 V513I probably damaging Het
Slco4a1 T A 2: 180,474,114 F681Y possibly damaging Het
Sp1 A G 15: 102,431,010 N775S possibly damaging Het
Sspo T A 6: 48,455,671 V827D probably damaging Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tars2 A T 3: 95,750,416 C238S probably damaging Het
Tnks1bp1 C A 2: 85,062,834 P373Q probably benign Het
Tnpo3 A G 6: 29,575,046 L373P probably damaging Het
Unc45b A C 11: 82,915,072 D135A possibly damaging Het
Vmn1r235 A T 17: 21,261,415 M1L probably benign Het
Vmn2r66 T C 7: 85,007,941 I85M probably damaging Het
Vmn2r80 T G 10: 79,168,232 L93W probably benign Het
Vwf G T 6: 125,673,887 probably benign Het
Ythdf3 A G 3: 16,183,922 R9G probably damaging Het
Zfp229 A G 17: 21,745,036 probably null Het
Zfp958 A C 8: 4,625,838 probably null Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 69817011 nonsense probably null
IGL02529:Gmip APN 8 69816789 missense probably damaging 0.99
IGL03185:Gmip APN 8 69809783 missense probably benign 0.02
IGL03328:Gmip APN 8 69811611 missense possibly damaging 0.79
microdot UTSW 8 69814135 missense probably damaging 1.00
minnox UTSW 8 69817802 missense probably benign 0.02
puncta UTSW 8 69816086 missense possibly damaging 0.50
R0110:Gmip UTSW 8 69815609 unclassified probably benign
R0329:Gmip UTSW 8 69810818 missense probably benign 0.06
R0330:Gmip UTSW 8 69810818 missense probably benign 0.06
R0510:Gmip UTSW 8 69815609 unclassified probably benign
R0638:Gmip UTSW 8 69811445 splice site probably benign
R1692:Gmip UTSW 8 69813903 missense probably benign
R1721:Gmip UTSW 8 69811232 missense probably damaging 0.96
R1755:Gmip UTSW 8 69814124 missense probably damaging 1.00
R1801:Gmip UTSW 8 69814477 missense probably benign
R1894:Gmip UTSW 8 69820972 missense probably damaging 1.00
R1926:Gmip UTSW 8 69815520 missense probably benign 0.41
R2005:Gmip UTSW 8 69814043 missense probably benign
R4280:Gmip UTSW 8 69813601 unclassified probably benign
R4281:Gmip UTSW 8 69813601 unclassified probably benign
R4282:Gmip UTSW 8 69813601 unclassified probably benign
R4283:Gmip UTSW 8 69813601 unclassified probably benign
R5221:Gmip UTSW 8 69814135 missense probably damaging 1.00
R5521:Gmip UTSW 8 69817399 missense probably damaging 1.00
R5763:Gmip UTSW 8 69817851 missense probably damaging 1.00
R6151:Gmip UTSW 8 69817085 missense probably damaging 1.00
R6163:Gmip UTSW 8 69817372 missense probably benign 0.28
R6228:Gmip UTSW 8 69816123 missense probably damaging 1.00
R6775:Gmip UTSW 8 69815635 missense possibly damaging 0.82
R6787:Gmip UTSW 8 69813786 missense probably damaging 1.00
R6788:Gmip UTSW 8 69811174 missense possibly damaging 0.87
R6788:Gmip UTSW 8 69811176 missense probably damaging 1.00
R6852:Gmip UTSW 8 69817991 nonsense probably null
R6934:Gmip UTSW 8 69820926 missense probably benign
R7010:Gmip UTSW 8 69811400 missense probably damaging 1.00
R7122:Gmip UTSW 8 69817802 missense probably benign 0.02
R7254:Gmip UTSW 8 69816468 splice site probably null
R7351:Gmip UTSW 8 69817384 missense probably benign 0.01
R7360:Gmip UTSW 8 69811242 missense probably damaging 1.00
R7412:Gmip UTSW 8 69820499 missense probably benign
R7577:Gmip UTSW 8 69814435 missense probably benign 0.17
R7718:Gmip UTSW 8 69817733 missense probably damaging 0.99
R8018:Gmip UTSW 8 69815493 missense probably benign 0.41
R8080:Gmip UTSW 8 69816086 missense possibly damaging 0.50
X0063:Gmip UTSW 8 69809816 missense probably damaging 1.00
Z1176:Gmip UTSW 8 69816292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCCTCCGATTCCATG -3'
(R):5'- CCAAGGCACTGTGGTGTTTG -3'

Sequencing Primer
(F):5'- CTACACATCCTCAGGGTGGCTG -3'
(R):5'- GGGGTCTGGGCTGGAATCC -3'
Posted On2016-11-08