Incidental Mutation 'R5512:Nrde2'
ID440124
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Namenrde-2 necessary for RNA interference, domain containing
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5512 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location100125452-100159653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100142250 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 361 (Q361K)
Ref Sequence ENSEMBL: ENSMUSP00000021596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021596] [ENSMUST00000221954]
Predicted Effect probably benign
Transcript: ENSMUST00000021596
AA Change: Q361K

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: Q361K

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221954
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,350,660 V364A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Adgre5 T C 8: 83,729,086 N198D probably benign Het
Adgrf4 G T 17: 42,667,285 T389K probably benign Het
Apc T A 18: 34,310,909 probably benign Het
Appl2 T A 10: 83,605,818 I524F probably damaging Het
Arhgef37 G A 18: 61,499,774 Q531* probably null Het
Atp7b T C 8: 22,012,739 T694A probably benign Het
Cacna1g T A 11: 94,444,142 I780F probably damaging Het
Calcoco2 T C 11: 96,103,336 K95E probably damaging Het
Cars T C 7: 143,570,133 D388G possibly damaging Het
Ccdc150 A C 1: 54,354,647 E690A probably damaging Het
Cdc73 G T 1: 143,702,616 D3E probably damaging Het
Cdh23 C A 10: 60,534,386 probably null Het
Cep170b T C 12: 112,733,485 S143P possibly damaging Het
Cherp T C 8: 72,463,266 I607V possibly damaging Het
CN725425 T A 15: 91,240,756 H166Q probably benign Het
Dcaf6 A G 1: 165,399,835 V241A possibly damaging Het
Dot1l C T 10: 80,788,991 P881S possibly damaging Het
Dsg1c A T 18: 20,272,511 N327I probably damaging Het
Fam208b A T 13: 3,595,517 Y111N probably damaging Het
Fbxw7 G A 3: 84,954,909 R182H probably damaging Het
Fkbp1b A T 12: 4,838,183 V24E probably benign Het
Fut11 T C 14: 20,696,001 S304P probably damaging Het
Ggt1 C T 10: 75,584,884 T361I probably damaging Het
Gimap7 G T 6: 48,723,596 A39S probably benign Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm17541 G T 12: 4,689,452 probably benign Het
Gmip T A 8: 69,817,890 V750E probably benign Het
Gna14 A G 19: 16,608,128 E290G probably benign Het
Gpnmb T C 6: 49,045,464 V176A possibly damaging Het
Hhla1 T C 15: 65,924,016 K447R probably benign Het
Hsd3b1 A G 3: 98,853,205 Y157H probably benign Het
Iqgap2 G A 13: 95,675,376 Q706* probably null Het
Krt222 A C 11: 99,234,955 S283R probably damaging Het
Ldb2 G A 5: 44,480,244 R241W probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Masp2 A T 4: 148,614,069 I536F probably damaging Het
Mptx1 A G 1: 174,332,749 D207G probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Napsa A G 7: 44,572,616 M1V probably null Het
Ncam1 A T 9: 49,509,699 probably null Het
Nckap5 G A 1: 126,027,744 P425L possibly damaging Het
Nol8 A G 13: 49,676,787 S1116G probably benign Het
Nudt13 G A 14: 20,307,732 G133D probably damaging Het
Ofcc1 G T 13: 40,206,810 Q248K probably benign Het
Olfm4 A G 14: 80,021,347 D345G probably benign Het
Olfr1287 G A 2: 111,449,754 V205I probably benign Het
Olfr720 C A 14: 14,175,633 G150C probably damaging Het
Osbpl3 T G 6: 50,309,360 K659N probably damaging Het
Pdk2 G A 11: 95,039,466 T48M probably damaging Het
Phf11a A T 14: 59,287,550 D68E probably benign Het
Prrxl1 A G 14: 32,600,044 H5R probably damaging Het
Purb A G 11: 6,475,702 V62A probably damaging Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rtl1 C T 12: 109,591,371 E1345K unknown Het
Sema3e G A 5: 14,230,180 A358T probably damaging Het
Slc29a2 A G 19: 5,026,398 I105V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc6a5 G A 7: 49,941,825 V513I probably damaging Het
Slco4a1 T A 2: 180,474,114 F681Y possibly damaging Het
Sp1 A G 15: 102,431,010 N775S possibly damaging Het
Sspo T A 6: 48,455,671 V827D probably damaging Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tars2 A T 3: 95,750,416 C238S probably damaging Het
Tnks1bp1 C A 2: 85,062,834 P373Q probably benign Het
Tnpo3 A G 6: 29,575,046 L373P probably damaging Het
Unc45b A C 11: 82,915,072 D135A possibly damaging Het
Vmn1r235 A T 17: 21,261,415 M1L probably benign Het
Vmn2r66 T C 7: 85,007,941 I85M probably damaging Het
Vmn2r80 T G 10: 79,168,232 L93W probably benign Het
Vwf G T 6: 125,673,887 probably benign Het
Ythdf3 A G 3: 16,183,922 R9G probably damaging Het
Zfp229 A G 17: 21,745,036 probably null Het
Zfp958 A C 8: 4,625,838 probably null Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0576:Nrde2 UTSW 12 100132233 missense possibly damaging 0.82
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6479:Nrde2 UTSW 12 100143948 missense probably benign 0.00
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7505:Nrde2 UTSW 12 100132498 missense probably benign 0.15
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7951:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CCAAACTGGCTCTGGCAAAAG -3'
(R):5'- TCAACAACGTCTTACTAGTGGC -3'

Sequencing Primer
(F):5'- AGATAGCGCTGCCACAGG -3'
(R):5'- CTTTTGTTGAAAGCTGGAAACCCAC -3'
Posted On2016-11-08