Incidental Mutation 'R5512:Iqgap2'
ID440130
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5512 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 95675376 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 706 (Q706*)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably null
Transcript: ENSMUST00000068603
AA Change: Q706*
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: Q706*

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,350,660 V364A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Adgre5 T C 8: 83,729,086 N198D probably benign Het
Adgrf4 G T 17: 42,667,285 T389K probably benign Het
Apc T A 18: 34,310,909 probably benign Het
Appl2 T A 10: 83,605,818 I524F probably damaging Het
Arhgef37 G A 18: 61,499,774 Q531* probably null Het
Atp7b T C 8: 22,012,739 T694A probably benign Het
Cacna1g T A 11: 94,444,142 I780F probably damaging Het
Calcoco2 T C 11: 96,103,336 K95E probably damaging Het
Cars T C 7: 143,570,133 D388G possibly damaging Het
Ccdc150 A C 1: 54,354,647 E690A probably damaging Het
Cdc73 G T 1: 143,702,616 D3E probably damaging Het
Cdh23 C A 10: 60,534,386 probably null Het
Cep170b T C 12: 112,733,485 S143P possibly damaging Het
Cherp T C 8: 72,463,266 I607V possibly damaging Het
CN725425 T A 15: 91,240,756 H166Q probably benign Het
Dcaf6 A G 1: 165,399,835 V241A possibly damaging Het
Dot1l C T 10: 80,788,991 P881S possibly damaging Het
Dsg1c A T 18: 20,272,511 N327I probably damaging Het
Fam208b A T 13: 3,595,517 Y111N probably damaging Het
Fbxw7 G A 3: 84,954,909 R182H probably damaging Het
Fkbp1b A T 12: 4,838,183 V24E probably benign Het
Fut11 T C 14: 20,696,001 S304P probably damaging Het
Ggt1 C T 10: 75,584,884 T361I probably damaging Het
Gimap7 G T 6: 48,723,596 A39S probably benign Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm17541 G T 12: 4,689,452 probably benign Het
Gmip T A 8: 69,817,890 V750E probably benign Het
Gna14 A G 19: 16,608,128 E290G probably benign Het
Gpnmb T C 6: 49,045,464 V176A possibly damaging Het
Hhla1 T C 15: 65,924,016 K447R probably benign Het
Hsd3b1 A G 3: 98,853,205 Y157H probably benign Het
Krt222 A C 11: 99,234,955 S283R probably damaging Het
Ldb2 G A 5: 44,480,244 R241W probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Masp2 A T 4: 148,614,069 I536F probably damaging Het
Mptx1 A G 1: 174,332,749 D207G probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Napsa A G 7: 44,572,616 M1V probably null Het
Ncam1 A T 9: 49,509,699 probably null Het
Nckap5 G A 1: 126,027,744 P425L possibly damaging Het
Nol8 A G 13: 49,676,787 S1116G probably benign Het
Nrde2 G T 12: 100,142,250 Q361K probably benign Het
Nudt13 G A 14: 20,307,732 G133D probably damaging Het
Ofcc1 G T 13: 40,206,810 Q248K probably benign Het
Olfm4 A G 14: 80,021,347 D345G probably benign Het
Olfr1287 G A 2: 111,449,754 V205I probably benign Het
Olfr720 C A 14: 14,175,633 G150C probably damaging Het
Osbpl3 T G 6: 50,309,360 K659N probably damaging Het
Pdk2 G A 11: 95,039,466 T48M probably damaging Het
Phf11a A T 14: 59,287,550 D68E probably benign Het
Prrxl1 A G 14: 32,600,044 H5R probably damaging Het
Purb A G 11: 6,475,702 V62A probably damaging Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rtl1 C T 12: 109,591,371 E1345K unknown Het
Sema3e G A 5: 14,230,180 A358T probably damaging Het
Slc29a2 A G 19: 5,026,398 I105V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc6a5 G A 7: 49,941,825 V513I probably damaging Het
Slco4a1 T A 2: 180,474,114 F681Y possibly damaging Het
Sp1 A G 15: 102,431,010 N775S possibly damaging Het
Sspo T A 6: 48,455,671 V827D probably damaging Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tars2 A T 3: 95,750,416 C238S probably damaging Het
Tnks1bp1 C A 2: 85,062,834 P373Q probably benign Het
Tnpo3 A G 6: 29,575,046 L373P probably damaging Het
Unc45b A C 11: 82,915,072 D135A possibly damaging Het
Vmn1r235 A T 17: 21,261,415 M1L probably benign Het
Vmn2r66 T C 7: 85,007,941 I85M probably damaging Het
Vmn2r80 T G 10: 79,168,232 L93W probably benign Het
Vwf G T 6: 125,673,887 probably benign Het
Ythdf3 A G 3: 16,183,922 R9G probably damaging Het
Zfp229 A G 17: 21,745,036 probably null Het
Zfp958 A C 8: 4,625,838 probably null Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCCCAGGACTAACTTGTAAGGC -3'
(R):5'- AAACTGGGTGCTAACCTGG -3'

Sequencing Primer
(F):5'- GTAAGGCTCACACATCTCTGG -3'
(R):5'- AACCTGGCCATTGGGTTC -3'
Posted On2016-11-08