Incidental Mutation 'R5513:Ints8'
ID 440163
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Name integrator complex subunit 8
Synonyms 2810013E07Rik, D130008D20Rik
MMRRC Submission 043073-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R5513 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 11199158-11254258 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11248303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 105 (V105A)
Ref Sequence ENSEMBL: ENSMUSP00000103954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
AlphaFold Q80V86
Predicted Effect possibly damaging
Transcript: ENSMUST00000044616
AA Change: V105A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108318
AA Change: V105A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108319
AA Change: V105A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,539,623 (GRCm39) probably null Het
Akr1b1 C A 6: 34,293,581 (GRCm39) probably benign Het
Alppl2 T A 1: 87,015,060 (GRCm39) N434Y probably benign Het
Ampd2 A G 3: 107,982,983 (GRCm39) I648T possibly damaging Het
Ankrd11 T C 8: 123,619,259 (GRCm39) E1510G probably benign Het
Ano2 A C 6: 126,016,285 (GRCm39) K939N possibly damaging Het
Arhgef5 A G 6: 43,249,273 (GRCm39) Y8C probably damaging Het
Aspm A T 1: 139,410,136 (GRCm39) I2609F probably damaging Het
Camsap2 A T 1: 136,208,601 (GRCm39) S964T probably benign Het
Cd22 C T 7: 30,566,450 (GRCm39) R823Q probably damaging Het
Cd74 T C 18: 60,944,377 (GRCm39) C196R probably damaging Het
Cfap73 A T 5: 120,769,777 (GRCm39) I82N probably damaging Het
Cidec A T 6: 113,405,140 (GRCm39) Y177N probably damaging Het
Crb1 C T 1: 139,164,559 (GRCm39) probably null Het
Cts7 T C 13: 61,503,398 (GRCm39) K189E possibly damaging Het
Cyp2c68 A T 19: 39,691,850 (GRCm39) Y358N probably damaging Het
Dab2ip A T 2: 35,600,266 (GRCm39) H294L probably benign Het
Dnah6 T C 6: 73,167,402 (GRCm39) D502G probably null Het
Dnah8 T A 17: 30,971,890 (GRCm39) M2768K probably damaging Het
Etl4 C A 2: 20,748,638 (GRCm39) S405R probably damaging Het
Fsip2 G T 2: 82,781,252 (GRCm39) L19F probably damaging Het
Fsip2 T A 2: 82,815,542 (GRCm39) N3758K possibly damaging Het
Fsip2 C G 2: 82,781,256 (GRCm39) Q217E probably benign Het
Gm12689 T C 4: 99,184,402 (GRCm39) I85T unknown Het
Hivep2 A T 10: 14,008,417 (GRCm39) K1672* probably null Het
Igkv2-137 G A 6: 67,532,998 (GRCm39) G54S possibly damaging Het
Lrba C T 3: 86,449,948 (GRCm39) S2089F probably damaging Het
Lrrc8b A G 5: 105,633,850 (GRCm39) K774R probably damaging Het
Mcm4 T A 16: 15,448,378 (GRCm39) Y393F probably benign Het
Mki67 A G 7: 135,309,479 (GRCm39) L324P probably damaging Het
Or4d6 A G 19: 12,086,745 (GRCm39) L55P probably damaging Het
Or52n3 A T 7: 104,530,706 (GRCm39) H264L probably damaging Het
Or5a3 G A 19: 12,400,047 (GRCm39) V125I probably benign Het
Or9s13 T C 1: 92,548,102 (GRCm39) V158A probably benign Het
Pld4 A G 12: 112,728,988 (GRCm39) E19G probably benign Het
Plvap T C 8: 71,964,173 (GRCm39) E63G probably damaging Het
Ppig A G 2: 69,580,703 (GRCm39) T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 142,862,463 (GRCm39) probably benign Het
Rbm15b A G 9: 106,763,316 (GRCm39) L284P probably benign Het
Relch G A 1: 105,678,698 (GRCm39) V1130I probably damaging Het
Rhbdl3 T C 11: 80,222,668 (GRCm39) V239A probably damaging Het
Sae1 T C 7: 16,100,781 (GRCm39) E197G probably benign Het
Sdhaf2 C T 19: 10,494,394 (GRCm39) R105H probably damaging Het
Senp3 T C 11: 69,567,965 (GRCm39) D425G probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc46a1 T C 11: 78,357,376 (GRCm39) F143S probably benign Het
Tom1 T A 8: 75,783,848 (GRCm39) N52K probably damaging Het
Vmn1r11 A T 6: 57,114,617 (GRCm39) T94S probably damaging Het
Zfp236 A G 18: 82,676,147 (GRCm39) I390T probably damaging Het
Zfp709 A T 8: 72,643,900 (GRCm39) H443L probably damaging Het
Zfp960 C T 17: 17,307,996 (GRCm39) P237S possibly damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11,218,679 (GRCm39) splice site probably benign
IGL01925:Ints8 APN 4 11,235,617 (GRCm39) splice site probably benign
IGL02195:Ints8 APN 4 11,221,222 (GRCm39) missense probably damaging 1.00
IGL02215:Ints8 APN 4 11,209,244 (GRCm39) missense probably damaging 1.00
IGL02429:Ints8 APN 4 11,231,720 (GRCm39) missense probably damaging 1.00
IGL02484:Ints8 APN 4 11,208,834 (GRCm39) nonsense probably null
IGL02558:Ints8 APN 4 11,218,771 (GRCm39) missense probably damaging 1.00
IGL02725:Ints8 APN 4 11,239,406 (GRCm39) missense probably benign 0.01
IGL02742:Ints8 APN 4 11,241,627 (GRCm39) missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11,245,896 (GRCm39) missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11,235,565 (GRCm39) missense probably damaging 1.00
IGL03171:Ints8 APN 4 11,231,702 (GRCm39) missense probably benign 0.01
IGL03335:Ints8 APN 4 11,216,460 (GRCm39) missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
P0026:Ints8 UTSW 4 11,225,788 (GRCm39) nonsense probably null
R0054:Ints8 UTSW 4 11,204,595 (GRCm39) utr 3 prime probably benign
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0184:Ints8 UTSW 4 11,218,637 (GRCm39) missense probably benign 0.03
R0299:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0499:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0540:Ints8 UTSW 4 11,252,926 (GRCm39) missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R1232:Ints8 UTSW 4 11,234,587 (GRCm39) missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11,221,204 (GRCm39) missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11,239,461 (GRCm39) missense probably benign 0.22
R1503:Ints8 UTSW 4 11,245,842 (GRCm39) missense probably damaging 0.97
R1587:Ints8 UTSW 4 11,245,722 (GRCm39) critical splice donor site probably null
R1701:Ints8 UTSW 4 11,231,656 (GRCm39) missense probably damaging 1.00
R1721:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1757:Ints8 UTSW 4 11,254,109 (GRCm39) start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11,225,600 (GRCm39) critical splice donor site probably null
R1867:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1868:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1952:Ints8 UTSW 4 11,221,150 (GRCm39) missense probably benign 0.21
R2084:Ints8 UTSW 4 11,230,377 (GRCm39) missense probably benign 0.31
R2108:Ints8 UTSW 4 11,235,552 (GRCm39) missense probably damaging 0.99
R2202:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11,225,725 (GRCm39) missense probably benign 0.29
R2504:Ints8 UTSW 4 11,241,642 (GRCm39) missense probably benign 0.03
R3824:Ints8 UTSW 4 11,225,621 (GRCm39) nonsense probably null
R4664:Ints8 UTSW 4 11,227,152 (GRCm39) missense probably benign 0.04
R4703:Ints8 UTSW 4 11,223,785 (GRCm39) missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11,230,367 (GRCm39) nonsense probably null
R5206:Ints8 UTSW 4 11,216,477 (GRCm39) missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11,211,916 (GRCm39) missense probably damaging 1.00
R5505:Ints8 UTSW 4 11,221,143 (GRCm39) missense probably benign 0.18
R5750:Ints8 UTSW 4 11,241,654 (GRCm39) missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11,223,813 (GRCm39) missense probably damaging 1.00
R6007:Ints8 UTSW 4 11,208,845 (GRCm39) missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11,252,891 (GRCm39) missense probably damaging 1.00
R6466:Ints8 UTSW 4 11,252,878 (GRCm39) missense probably damaging 0.99
R6709:Ints8 UTSW 4 11,221,117 (GRCm39) missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11,204,474 (GRCm39) missense probably damaging 1.00
R6998:Ints8 UTSW 4 11,204,537 (GRCm39) missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11,204,574 (GRCm39) missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11,225,613 (GRCm39) missense probably benign 0.01
R7772:Ints8 UTSW 4 11,227,190 (GRCm39) missense probably damaging 0.97
R7872:Ints8 UTSW 4 11,254,062 (GRCm39) missense probably benign 0.00
R7953:Ints8 UTSW 4 11,227,128 (GRCm39) missense probably benign
R8184:Ints8 UTSW 4 11,204,534 (GRCm39) missense probably damaging 1.00
R8301:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
R8708:Ints8 UTSW 4 11,208,824 (GRCm39) critical splice donor site probably null
R8868:Ints8 UTSW 4 11,230,488 (GRCm39) missense probably benign
R9245:Ints8 UTSW 4 11,213,811 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CGCTTGGAGCAAAAGGAGATCC -3'
(R):5'- TACGTATGTCATGGATGCGC -3'

Sequencing Primer
(F):5'- AGGAGATCCTTAAAAGCACAGCTTC -3'
(R):5'- ATGGATGCGCATCGTTCC -3'
Posted On 2016-11-08