Incidental Mutation 'R5513:Sae1'
ID 440178
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms 2400010M20Rik, SUMO-1 activating enzyme subunit 1, HSPC140, AOS1, Uble1a, 2610044L12Rik, D7Ertd177e
MMRRC Submission 043073-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R5513 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 16054159-16121731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16100781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 197 (E197G)
Ref Sequence ENSEMBL: ENSMUSP00000147771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably benign
Transcript: ENSMUST00000094815
AA Change: E197G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: E197G

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209749
Predicted Effect probably benign
Transcript: ENSMUST00000210999
AA Change: E197G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000211741
AA Change: E197G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,539,623 (GRCm39) probably null Het
Akr1b1 C A 6: 34,293,581 (GRCm39) probably benign Het
Alppl2 T A 1: 87,015,060 (GRCm39) N434Y probably benign Het
Ampd2 A G 3: 107,982,983 (GRCm39) I648T possibly damaging Het
Ankrd11 T C 8: 123,619,259 (GRCm39) E1510G probably benign Het
Ano2 A C 6: 126,016,285 (GRCm39) K939N possibly damaging Het
Arhgef5 A G 6: 43,249,273 (GRCm39) Y8C probably damaging Het
Aspm A T 1: 139,410,136 (GRCm39) I2609F probably damaging Het
Camsap2 A T 1: 136,208,601 (GRCm39) S964T probably benign Het
Cd22 C T 7: 30,566,450 (GRCm39) R823Q probably damaging Het
Cd74 T C 18: 60,944,377 (GRCm39) C196R probably damaging Het
Cfap73 A T 5: 120,769,777 (GRCm39) I82N probably damaging Het
Cidec A T 6: 113,405,140 (GRCm39) Y177N probably damaging Het
Crb1 C T 1: 139,164,559 (GRCm39) probably null Het
Cts7 T C 13: 61,503,398 (GRCm39) K189E possibly damaging Het
Cyp2c68 A T 19: 39,691,850 (GRCm39) Y358N probably damaging Het
Dab2ip A T 2: 35,600,266 (GRCm39) H294L probably benign Het
Dnah6 T C 6: 73,167,402 (GRCm39) D502G probably null Het
Dnah8 T A 17: 30,971,890 (GRCm39) M2768K probably damaging Het
Etl4 C A 2: 20,748,638 (GRCm39) S405R probably damaging Het
Fsip2 G T 2: 82,781,252 (GRCm39) L19F probably damaging Het
Fsip2 T A 2: 82,815,542 (GRCm39) N3758K possibly damaging Het
Fsip2 C G 2: 82,781,256 (GRCm39) Q217E probably benign Het
Gm12689 T C 4: 99,184,402 (GRCm39) I85T unknown Het
Hivep2 A T 10: 14,008,417 (GRCm39) K1672* probably null Het
Igkv2-137 G A 6: 67,532,998 (GRCm39) G54S possibly damaging Het
Ints8 A G 4: 11,248,303 (GRCm39) V105A possibly damaging Het
Lrba C T 3: 86,449,948 (GRCm39) S2089F probably damaging Het
Lrrc8b A G 5: 105,633,850 (GRCm39) K774R probably damaging Het
Mcm4 T A 16: 15,448,378 (GRCm39) Y393F probably benign Het
Mki67 A G 7: 135,309,479 (GRCm39) L324P probably damaging Het
Or4d6 A G 19: 12,086,745 (GRCm39) L55P probably damaging Het
Or52n3 A T 7: 104,530,706 (GRCm39) H264L probably damaging Het
Or5a3 G A 19: 12,400,047 (GRCm39) V125I probably benign Het
Or9s13 T C 1: 92,548,102 (GRCm39) V158A probably benign Het
Pld4 A G 12: 112,728,988 (GRCm39) E19G probably benign Het
Plvap T C 8: 71,964,173 (GRCm39) E63G probably damaging Het
Ppig A G 2: 69,580,703 (GRCm39) T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 142,862,463 (GRCm39) probably benign Het
Rbm15b A G 9: 106,763,316 (GRCm39) L284P probably benign Het
Relch G A 1: 105,678,698 (GRCm39) V1130I probably damaging Het
Rhbdl3 T C 11: 80,222,668 (GRCm39) V239A probably damaging Het
Sdhaf2 C T 19: 10,494,394 (GRCm39) R105H probably damaging Het
Senp3 T C 11: 69,567,965 (GRCm39) D425G probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc46a1 T C 11: 78,357,376 (GRCm39) F143S probably benign Het
Tom1 T A 8: 75,783,848 (GRCm39) N52K probably damaging Het
Vmn1r11 A T 6: 57,114,617 (GRCm39) T94S probably damaging Het
Zfp236 A G 18: 82,676,147 (GRCm39) I390T probably damaging Het
Zfp709 A T 8: 72,643,900 (GRCm39) H443L probably damaging Het
Zfp960 C T 17: 17,307,996 (GRCm39) P237S possibly damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16,064,581 (GRCm39) missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16,104,273 (GRCm39) missense probably damaging 1.00
IGL02881:Sae1 APN 7 16,093,043 (GRCm39) missense probably damaging 1.00
R0255:Sae1 UTSW 7 16,104,247 (GRCm39) nonsense probably null
R0667:Sae1 UTSW 7 16,102,457 (GRCm39) missense probably damaging 1.00
R1374:Sae1 UTSW 7 16,112,333 (GRCm39) missense probably damaging 0.97
R1585:Sae1 UTSW 7 16,064,537 (GRCm39) critical splice donor site probably null
R1960:Sae1 UTSW 7 16,102,490 (GRCm39) missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16,104,291 (GRCm39) missense probably damaging 1.00
R5677:Sae1 UTSW 7 16,104,387 (GRCm39) critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16,102,461 (GRCm39) missense probably damaging 1.00
R6975:Sae1 UTSW 7 16,070,712 (GRCm39) missense probably damaging 0.99
R7307:Sae1 UTSW 7 16,102,469 (GRCm39) nonsense probably null
R7914:Sae1 UTSW 7 16,121,648 (GRCm39) missense unknown
R8437:Sae1 UTSW 7 16,104,279 (GRCm39) missense probably damaging 1.00
R9076:Sae1 UTSW 7 16,070,668 (GRCm39) missense probably benign
Z1177:Sae1 UTSW 7 16,061,796 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCATTTTCTCGGGAGG -3'
(R):5'- AGCTCAGGCCTCATTGATTC -3'

Sequencing Primer
(F):5'- GAGAGAGCTGCCTGGAATC -3'
(R):5'- ATCAAGGCAGGATTTCTCTGTAGCC -3'
Posted On 2016-11-08