Incidental Mutation 'R5513:Tom1'
ID440186
Institutional Source Beutler Lab
Gene Symbol Tom1
Ensembl Gene ENSMUSG00000042870
Gene Nametarget of myb1 trafficking protein
Synonyms
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75033705-75070121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75057220 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 52 (N52K)
Ref Sequence ENSEMBL: ENSMUSP00000148271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078847] [ENSMUST00000165630] [ENSMUST00000212299] [ENSMUST00000212388] [ENSMUST00000212651]
Predicted Effect probably damaging
Transcript: ENSMUST00000078847
AA Change: N277K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077891
Gene: ENSMUSG00000042870
AA Change: N277K

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 228 303 1.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165630
AA Change: N277K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130854
Gene: ENSMUSG00000042870
AA Change: N277K

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 212 312 5.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212278
Predicted Effect probably benign
Transcript: ENSMUST00000212299
Predicted Effect probably damaging
Transcript: ENSMUST00000212388
AA Change: N52K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212651
Meta Mutation Damage Score 0.7718 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Tom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tom1 APN 8 75052174 missense probably benign 0.27
IGL00979:Tom1 APN 8 75054703 unclassified probably benign
IGL01143:Tom1 APN 8 75058457 missense probably benign 0.00
IGL02825:Tom1 APN 8 75057255 missense probably damaging 1.00
R0335:Tom1 UTSW 8 75064392 critical splice acceptor site probably null
R0762:Tom1 UTSW 8 75052306 splice site probably benign
R1317:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1509:Tom1 UTSW 8 75054631 missense probably damaging 1.00
R1691:Tom1 UTSW 8 75051599 missense probably damaging 1.00
R1761:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1906:Tom1 UTSW 8 75051590 missense probably damaging 1.00
R3966:Tom1 UTSW 8 75059239 missense probably benign 0.05
R5004:Tom1 UTSW 8 75052002 missense probably damaging 1.00
R5906:Tom1 UTSW 8 75050258 missense probably damaging 1.00
R6147:Tom1 UTSW 8 75054692 missense possibly damaging 0.90
R6964:Tom1 UTSW 8 75051965 missense probably null 1.00
R7010:Tom1 UTSW 8 75051975 missense probably damaging 0.98
R7131:Tom1 UTSW 8 75057249 missense possibly damaging 0.88
R7147:Tom1 UTSW 8 75057267 missense probably damaging 1.00
R8701:Tom1 UTSW 8 75052168 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGAGAACAGGCTTGTGGAG -3'
(R):5'- TCTAGAGCAGAGCACTTTGC -3'

Sequencing Primer
(F):5'- TTGTGGAGCCATGAAGACCC -3'
(R):5'- CCAAGCAGCTCAGTGACG -3'
Posted On2016-11-08