Incidental Mutation 'R5513:Rhbdl3'
ID440192
Institutional Source Beutler Lab
Gene Symbol Rhbdl3
Ensembl Gene ENSMUSG00000017692
Gene Namerhomboid like 3
SynonymsVrho, Ventrhoid, Rhbdl4
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80300912-80355955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80331842 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 239 (V239A)
Ref Sequence ENSEMBL: ENSMUSP00000017836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017836]
Predicted Effect probably damaging
Transcript: ENSMUST00000017836
AA Change: V239A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017836
Gene: ENSMUSG00000017692
AA Change: V239A

DomainStartEndE-ValueType
SCOP:d1c7va_ 36 104 2e-12 SMART
Blast:EFh 38 66 6e-11 BLAST
PDB:2RRT|A 43 102 6e-6 PDB
Blast:EFh 74 102 9e-10 BLAST
transmembrane domain 162 184 N/A INTRINSIC
Pfam:Rhomboid 205 362 1.6e-34 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Meta Mutation Damage Score 0.5139 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Rhbdl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Rhbdl3 APN 11 80353442 missense probably damaging 1.00
IGL02003:Rhbdl3 APN 11 80337516 missense possibly damaging 0.82
IGL02302:Rhbdl3 APN 11 80353681 makesense probably null
IGL02972:Rhbdl3 APN 11 80331916 splice site probably benign
IGL03028:Rhbdl3 APN 11 80323461 nonsense probably null
IGL03033:Rhbdl3 APN 11 80346827 missense probably damaging 0.99
IGL03113:Rhbdl3 APN 11 80353613 missense possibly damaging 0.69
R0193:Rhbdl3 UTSW 11 80353574 missense possibly damaging 0.55
R0358:Rhbdl3 UTSW 11 80353631 missense probably damaging 0.99
R0481:Rhbdl3 UTSW 11 80323349 splice site probably benign
R0616:Rhbdl3 UTSW 11 80331861 missense probably damaging 0.99
R1171:Rhbdl3 UTSW 11 80353592 missense possibly damaging 0.52
R2166:Rhbdl3 UTSW 11 80319697 missense probably damaging 1.00
R3500:Rhbdl3 UTSW 11 80319705 missense probably damaging 0.98
R4580:Rhbdl3 UTSW 11 80353645 missense probably damaging 1.00
R4900:Rhbdl3 UTSW 11 80319613 missense probably benign 0.13
R5276:Rhbdl3 UTSW 11 80319666 missense probably benign 0.07
R5595:Rhbdl3 UTSW 11 80337583 missense probably damaging 0.99
R5941:Rhbdl3 UTSW 11 80331889 missense probably benign 0.18
R6372:Rhbdl3 UTSW 11 80330656 missense probably damaging 1.00
R6935:Rhbdl3 UTSW 11 80337496 missense probably damaging 1.00
R7252:Rhbdl3 UTSW 11 80337585 missense possibly damaging 0.60
R7389:Rhbdl3 UTSW 11 80346839 missense possibly damaging 0.95
R7404:Rhbdl3 UTSW 11 80346833 missense probably damaging 1.00
R7745:Rhbdl3 UTSW 11 80323579 missense possibly damaging 0.74
R7768:Rhbdl3 UTSW 11 80330621 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCATGAGAGTCAAGTCC -3'
(R):5'- GCTGTGGGAAATATGCCTAGC -3'

Sequencing Primer
(F):5'- TGAGAGTCAAGTCCCCTCC -3'
(R):5'- GACAATTCTGAGTCAGGGACCC -3'
Posted On2016-11-08