Incidental Mutation 'R5513:Pld4'
ID 440194
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Name phospholipase D family member 4
Synonyms thss
MMRRC Submission 043073-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5513 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 112727089-112735420 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112728988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 19 (E19G)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888]
AlphaFold Q8BG07
Predicted Effect probably benign
Transcript: ENSMUST00000063888
AA Change: E19G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: E19G

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222886
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,539,623 (GRCm39) probably null Het
Akr1b1 C A 6: 34,293,581 (GRCm39) probably benign Het
Alppl2 T A 1: 87,015,060 (GRCm39) N434Y probably benign Het
Ampd2 A G 3: 107,982,983 (GRCm39) I648T possibly damaging Het
Ankrd11 T C 8: 123,619,259 (GRCm39) E1510G probably benign Het
Ano2 A C 6: 126,016,285 (GRCm39) K939N possibly damaging Het
Arhgef5 A G 6: 43,249,273 (GRCm39) Y8C probably damaging Het
Aspm A T 1: 139,410,136 (GRCm39) I2609F probably damaging Het
Camsap2 A T 1: 136,208,601 (GRCm39) S964T probably benign Het
Cd22 C T 7: 30,566,450 (GRCm39) R823Q probably damaging Het
Cd74 T C 18: 60,944,377 (GRCm39) C196R probably damaging Het
Cfap73 A T 5: 120,769,777 (GRCm39) I82N probably damaging Het
Cidec A T 6: 113,405,140 (GRCm39) Y177N probably damaging Het
Crb1 C T 1: 139,164,559 (GRCm39) probably null Het
Cts7 T C 13: 61,503,398 (GRCm39) K189E possibly damaging Het
Cyp2c68 A T 19: 39,691,850 (GRCm39) Y358N probably damaging Het
Dab2ip A T 2: 35,600,266 (GRCm39) H294L probably benign Het
Dnah6 T C 6: 73,167,402 (GRCm39) D502G probably null Het
Dnah8 T A 17: 30,971,890 (GRCm39) M2768K probably damaging Het
Etl4 C A 2: 20,748,638 (GRCm39) S405R probably damaging Het
Fsip2 G T 2: 82,781,252 (GRCm39) L19F probably damaging Het
Fsip2 T A 2: 82,815,542 (GRCm39) N3758K possibly damaging Het
Fsip2 C G 2: 82,781,256 (GRCm39) Q217E probably benign Het
Gm12689 T C 4: 99,184,402 (GRCm39) I85T unknown Het
Hivep2 A T 10: 14,008,417 (GRCm39) K1672* probably null Het
Igkv2-137 G A 6: 67,532,998 (GRCm39) G54S possibly damaging Het
Ints8 A G 4: 11,248,303 (GRCm39) V105A possibly damaging Het
Lrba C T 3: 86,449,948 (GRCm39) S2089F probably damaging Het
Lrrc8b A G 5: 105,633,850 (GRCm39) K774R probably damaging Het
Mcm4 T A 16: 15,448,378 (GRCm39) Y393F probably benign Het
Mki67 A G 7: 135,309,479 (GRCm39) L324P probably damaging Het
Or4d6 A G 19: 12,086,745 (GRCm39) L55P probably damaging Het
Or52n3 A T 7: 104,530,706 (GRCm39) H264L probably damaging Het
Or5a3 G A 19: 12,400,047 (GRCm39) V125I probably benign Het
Or9s13 T C 1: 92,548,102 (GRCm39) V158A probably benign Het
Plvap T C 8: 71,964,173 (GRCm39) E63G probably damaging Het
Ppig A G 2: 69,580,703 (GRCm39) T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 142,862,463 (GRCm39) probably benign Het
Rbm15b A G 9: 106,763,316 (GRCm39) L284P probably benign Het
Relch G A 1: 105,678,698 (GRCm39) V1130I probably damaging Het
Rhbdl3 T C 11: 80,222,668 (GRCm39) V239A probably damaging Het
Sae1 T C 7: 16,100,781 (GRCm39) E197G probably benign Het
Sdhaf2 C T 19: 10,494,394 (GRCm39) R105H probably damaging Het
Senp3 T C 11: 69,567,965 (GRCm39) D425G probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc46a1 T C 11: 78,357,376 (GRCm39) F143S probably benign Het
Tom1 T A 8: 75,783,848 (GRCm39) N52K probably damaging Het
Vmn1r11 A T 6: 57,114,617 (GRCm39) T94S probably damaging Het
Zfp236 A G 18: 82,676,147 (GRCm39) I390T probably damaging Het
Zfp709 A T 8: 72,643,900 (GRCm39) H443L probably damaging Het
Zfp960 C T 17: 17,307,996 (GRCm39) P237S possibly damaging Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112,729,925 (GRCm39) missense probably benign 0.01
IGL01839:Pld4 APN 12 112,731,513 (GRCm39) missense probably damaging 1.00
IGL01954:Pld4 APN 12 112,734,355 (GRCm39) critical splice donor site probably null
IGL02253:Pld4 APN 12 112,733,141 (GRCm39) missense probably damaging 1.00
IGL03149:Pld4 APN 12 112,733,263 (GRCm39) missense probably benign 0.00
IGL03278:Pld4 APN 12 112,733,165 (GRCm39) missense probably damaging 0.98
IGL03349:Pld4 APN 12 112,734,313 (GRCm39) missense probably benign 0.01
Lipodicum UTSW 12 112,731,498 (GRCm39) missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112,734,256 (GRCm39) missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112,734,256 (GRCm39) missense probably damaging 1.00
R0052:Pld4 UTSW 12 112,734,291 (GRCm39) missense probably benign 0.03
R1078:Pld4 UTSW 12 112,729,876 (GRCm39) missense probably benign
R1756:Pld4 UTSW 12 112,729,826 (GRCm39) splice site probably null
R2006:Pld4 UTSW 12 112,734,923 (GRCm39) missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112,734,992 (GRCm39) missense probably damaging 1.00
R3738:Pld4 UTSW 12 112,734,469 (GRCm39) missense probably benign 0.07
R4630:Pld4 UTSW 12 112,731,498 (GRCm39) missense probably damaging 1.00
R4911:Pld4 UTSW 12 112,730,951 (GRCm39) missense probably benign 0.01
R5008:Pld4 UTSW 12 112,734,484 (GRCm39) missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112,731,465 (GRCm39) missense probably damaging 1.00
R5310:Pld4 UTSW 12 112,735,046 (GRCm39) missense probably damaging 1.00
R5386:Pld4 UTSW 12 112,730,422 (GRCm39) nonsense probably null
R5788:Pld4 UTSW 12 112,730,551 (GRCm39) missense probably benign
R6085:Pld4 UTSW 12 112,733,320 (GRCm39) missense probably benign 0.01
R6157:Pld4 UTSW 12 112,734,535 (GRCm39) missense probably damaging 1.00
R6702:Pld4 UTSW 12 112,731,485 (GRCm39) missense probably damaging 1.00
R6767:Pld4 UTSW 12 112,730,549 (GRCm39) missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112,733,288 (GRCm39) missense probably benign 0.00
R7864:Pld4 UTSW 12 112,731,557 (GRCm39) missense probably damaging 1.00
R8792:Pld4 UTSW 12 112,729,924 (GRCm39) missense probably benign 0.00
R8826:Pld4 UTSW 12 112,733,210 (GRCm39) missense possibly damaging 0.95
R9790:Pld4 UTSW 12 112,734,862 (GRCm39) missense probably damaging 1.00
R9791:Pld4 UTSW 12 112,734,862 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGGGTACAAGCAGGACAC -3'
(R):5'- AGTTTTGTACCCTCTAATCAAACCC -3'

Sequencing Primer
(F):5'- CCTGGGAAAGGTGTAGGCTC -3'
(R):5'- AATGGGATTCAGATGCCCTC -3'
Posted On 2016-11-08