Incidental Mutation 'R5514:Ncoa2'
ID440205
Institutional Source Beutler Lab
Gene Symbol Ncoa2
Ensembl Gene ENSMUSG00000005886
Gene Namenuclear receptor coactivator 2
SynonymsSRC-2, TIF2, glucocorticoid receptor-interacting protein 1, D1Ertd433e, KAT13C, bHLHe75, TIF2/GRIP-1, TIF-2, Grip1
MMRRC Submission 043074-MU
Accession Numbers

Ncbi RefSeq: NM_008678.2, NM_001077695.1; MGI: 1276533

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location13139105-13374083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13181221 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 276 (L276H)
Ref Sequence ENSEMBL: ENSMUSP00000080413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006037] [ENSMUST00000068304] [ENSMUST00000081713]
Predicted Effect probably damaging
Transcript: ENSMUST00000006037
AA Change: L276H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006037
Gene: ENSMUSG00000005886
AA Change: L276H

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:NCOA_u2 463 587 6.7e-39 PFAM
Pfam:SRC-1 636 709 5.8e-23 PFAM
Pfam:DUF4927 731 816 2.7e-33 PFAM
low complexity region 1021 1037 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1071 1117 6.5e-27 PFAM
low complexity region 1183 1204 N/A INTRINSIC
low complexity region 1243 1264 N/A INTRINSIC
DUF1518 1279 1336 5.92e-28 SMART
low complexity region 1409 1420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068304
AA Change: L276H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069509
Gene: ENSMUSG00000005886
AA Change: L276H

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081713
AA Change: L276H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080413
Gene: ENSMUSG00000005886
AA Change: L276H

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195493
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 2183803
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a transcriptional coactivator for nuclear hormone receptors, including steroid, thyroid, retinoid, and vitamin D receptors. The encoded protein acts as an intermediary factor for the ligand-dependent activity of these nuclear receptors, which regulate their target genes upon binding of cognate response elements. This gene has been found to be involved in translocations that result in fusions with other genes in various cancers, including the lysine acetyltransferase 6A (KAT6A) gene in acute myeloid leukemia, the ETS variant 6 (ETV6) gene in acute lymphoblastic leukemia, and the hes related family bHLH transcription factor with YRPW motif 1 (HEY1) gene in mesenchymal chondrosarcoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice exhibit a transient postnatal growth deficiency and hypofertility. Male hypofertility is due to defects in spermiogenesis and an age-dependent testicular degeneration preceded by defective lipid metabolism in Sertoli cells. Female hypofertility is due to a placental hypoplasia. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted(4) Gene trapped(39)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Ncoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Ncoa2 APN 1 13149079 missense possibly damaging 0.91
IGL01469:Ncoa2 APN 1 13186869 missense probably benign 0.02
IGL01735:Ncoa2 APN 1 13164903 missense probably benign 0.01
IGL01799:Ncoa2 APN 1 13152375 splice site probably benign
IGL02023:Ncoa2 APN 1 13174854 missense probably damaging 1.00
IGL02115:Ncoa2 APN 1 13152817 missense probably damaging 1.00
IGL02263:Ncoa2 APN 1 13174763 missense probably damaging 1.00
IGL03131:Ncoa2 APN 1 13177174 missense probably damaging 0.98
IGL03189:Ncoa2 APN 1 13190136 missense probably damaging 1.00
IGL03240:Ncoa2 APN 1 13177092 missense probably damaging 1.00
R0017:Ncoa2 UTSW 1 13174752 missense probably damaging 1.00
R0056:Ncoa2 UTSW 1 117516497 critical splice donor site probably null
R0158:Ncoa2 UTSW 1 13152384 missense probably benign 0.05
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0684:Ncoa2 UTSW 1 13224651 missense probably damaging 0.99
R0788:Ncoa2 UTSW 1 13166889 splice site probably benign
R1433:Ncoa2 UTSW 1 13148378 missense probably benign 0.01
R1517:Ncoa2 UTSW 1 13165057 missense probably benign 0.33
R1799:Ncoa2 UTSW 1 13162293 splice site probably null
R1959:Ncoa2 UTSW 1 13160252 missense probably damaging 1.00
R2034:Ncoa2 UTSW 1 13164983 missense probably benign 0.00
R2175:Ncoa2 UTSW 1 13224613 missense probably damaging 0.96
R2437:Ncoa2 UTSW 1 13148360 missense probably damaging 0.98
R2851:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R2853:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R4334:Ncoa2 UTSW 1 13174963 missense possibly damaging 0.77
R4365:Ncoa2 UTSW 1 13180547 missense probably damaging 0.96
R4386:Ncoa2 UTSW 1 13177165 missense probably damaging 0.99
R4516:Ncoa2 UTSW 1 13146906 missense probably damaging 0.99
R5109:Ncoa2 UTSW 1 13186846 missense probably damaging 1.00
R5162:Ncoa2 UTSW 1 13175172 missense possibly damaging 0.79
R5183:Ncoa2 UTSW 1 13174366 missense probably damaging 1.00
R5250:Ncoa2 UTSW 1 13224689 missense probably damaging 1.00
R5691:Ncoa2 UTSW 1 13180550 missense probably damaging 0.99
R5837:Ncoa2 UTSW 1 13224706 utr 5 prime probably benign
R6003:Ncoa2 UTSW 1 13167030 missense possibly damaging 0.81
R6134:Ncoa2 UTSW 1 13174371 missense probably damaging 1.00
R6559:Ncoa2 UTSW 1 13150617 intron probably null
R6623:Ncoa2 UTSW 1 13181297 missense probably damaging 0.99
R6949:Ncoa2 UTSW 1 13156501 missense possibly damaging 0.92
R7090:Ncoa2 UTSW 1 13186838 missense probably damaging 1.00
R7251:Ncoa2 UTSW 1 13148375 missense probably benign 0.01
R7389:Ncoa2 UTSW 1 13186825 missense possibly damaging 0.62
R7565:Ncoa2 UTSW 1 13148376 missense probably benign 0.03
X0063:Ncoa2 UTSW 1 13175238 missense possibly damaging 0.82
X0066:Ncoa2 UTSW 1 13148449 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AACTGCTGTTTGGAGATGGCAG -3'
(R):5'- AGCTGAGAACCATGGCAACTC -3'

Sequencing Primer
(F):5'- CTGTTTGGAGATGGCAGCCTAAATAC -3'
(R):5'- TGGCAACTCATTGATTCACCAGG -3'
Posted On2016-11-08