Incidental Mutation 'R5514:Olfr1229'
ID440212
Institutional Source Beutler Lab
Gene Symbol Olfr1229
Ensembl Gene ENSMUSG00000075095
Gene Nameolfactory receptor 1229
SynonymsMOR233-19, MOR233-22, GA_x6K02T2Q125-50727797-50726862
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89280476-89288014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89282473 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 220 (I220N)
Ref Sequence ENSEMBL: ENSMUSP00000150344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099788] [ENSMUST00000213883] [ENSMUST00000214593]
Predicted Effect probably damaging
Transcript: ENSMUST00000099788
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097376
Gene: ENSMUSG00000075095
AA Change: I220N

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2.9e-29 PFAM
Pfam:7tm_4 138 279 1.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111549
AA Change: I241N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107174
Gene: ENSMUSG00000075095
AA Change: I241N

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 49 324 9.6e-51 PFAM
Pfam:7tm_1 60 307 7.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213883
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214593
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Olfr1229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02982:Olfr1229 APN 2 89283109 missense probably damaging 0.98
R1535:Olfr1229 UTSW 2 89283057 missense probably benign 0.14
R1610:Olfr1229 UTSW 2 89282821 missense probably damaging 1.00
R3896:Olfr1229 UTSW 2 89283097 missense possibly damaging 0.78
R4516:Olfr1229 UTSW 2 89282843 missense probably benign 0.05
R4922:Olfr1229 UTSW 2 89282467 missense possibly damaging 0.93
R4990:Olfr1229 UTSW 2 89283327 intron probably null
R5267:Olfr1229 UTSW 2 89282230 nonsense probably null
R5271:Olfr1229 UTSW 2 89282953 missense probably benign 0.39
R5621:Olfr1229 UTSW 2 89282353 missense probably damaging 0.97
R7154:Olfr1229 UTSW 2 89282860 missense probably damaging 1.00
Z1176:Olfr1229 UTSW 2 89282537 missense probably benign 0.03
Z1176:Olfr1229 UTSW 2 89282897 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGATAGCATGGTGTAAAATATTGC -3'
(R):5'- ATCATGACCCTGAGGCTCTG -3'

Sequencing Primer
(F):5'- GCTACCATTTTGTCAAAGGAAAAGGC -3'
(R):5'- CTGGACAGGAGGATTCTTACACTC -3'
Posted On2016-11-08