Incidental Mutation 'R5514:Elf2'
ID440216
Institutional Source Beutler Lab
Gene Symbol Elf2
Ensembl Gene ENSMUSG00000037174
Gene NameE74-like factor 2
Synonyms2610036A20Rik, A230104O07Rik, NERF-2
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51252720-51340663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 51308134 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 52 (Q52K)
Ref Sequence ENSEMBL: ENSMUSP00000139358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062009] [ENSMUST00000163748] [ENSMUST00000183338] [ENSMUST00000183463] [ENSMUST00000194641]
Predicted Effect probably damaging
Transcript: ENSMUST00000062009
AA Change: Q52K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061076
Gene: ENSMUSG00000037174
AA Change: Q52K

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 2.2e-37 PFAM
low complexity region 130 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
ETS 195 282 1.28e-51 SMART
low complexity region 357 379 N/A INTRINSIC
low complexity region 411 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163748
AA Change: Q52K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126871
Gene: ENSMUSG00000037174
AA Change: Q52K

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183338
AA Change: Q52K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139358
Gene: ENSMUSG00000037174
AA Change: Q52K

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 80 3.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183463
AA Change: Q52K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139360
Gene: ENSMUSG00000037174
AA Change: Q52K

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 85 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194209
Predicted Effect probably damaging
Transcript: ENSMUST00000194641
AA Change: Q52K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174
AA Change: Q52K

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Elf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Elf2 APN 3 51308046 critical splice donor site probably benign 0.00
IGL01577:Elf2 APN 3 51256352 utr 3 prime probably benign
IGL01829:Elf2 APN 3 51308100 missense probably damaging 0.98
IGL02974:Elf2 APN 3 51257689 missense probably damaging 0.98
IGL03244:Elf2 APN 3 51257772 nonsense probably null
IGL02980:Elf2 UTSW 3 51264958 missense possibly damaging 0.89
IGL03050:Elf2 UTSW 3 51257617 missense probably benign 0.05
R0254:Elf2 UTSW 3 51308190 missense probably damaging 1.00
R0594:Elf2 UTSW 3 51256453 missense possibly damaging 0.64
R0644:Elf2 UTSW 3 51308131 missense probably damaging 1.00
R1638:Elf2 UTSW 3 51308109 missense probably damaging 1.00
R1729:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R1784:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R2142:Elf2 UTSW 3 51256440 missense probably damaging 1.00
R2346:Elf2 UTSW 3 51257444 missense probably benign
R4366:Elf2 UTSW 3 51308149 nonsense probably null
R4672:Elf2 UTSW 3 51256434 missense probably damaging 1.00
R4834:Elf2 UTSW 3 51277221 missense probably damaging 1.00
R6198:Elf2 UTSW 3 51277249 missense probably damaging 1.00
R6870:Elf2 UTSW 3 51294165 makesense probably null
R7129:Elf2 UTSW 3 51261011 missense probably damaging 0.96
R7328:Elf2 UTSW 3 51266777 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTTCTTCAGTATAAGCTTCCCC -3'
(R):5'- CTGAATGACCTTGTGTGAAGCC -3'

Sequencing Primer
(F):5'- CTCAGCAGTTAAGAGCGCTG -3'
(R):5'- ACCTTGTGTGAAGCCGAGTCAC -3'
Posted On2016-11-08