Incidental Mutation 'R5514:Mtor'
ID440221
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 043074-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148546444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2286 (V2286E)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably damaging
Transcript: ENSMUST00000103221
AA Change: V2286E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V2286E

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129715
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
R7697:Mtor UTSW 4 148540308 nonsense probably null
R7737:Mtor UTSW 4 148538738 missense possibly damaging 0.95
R7791:Mtor UTSW 4 148462940 missense probably benign 0.00
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GATCTCTGAGTTCGAGGCCATC -3'
(R):5'- GGAGCCACGGGATCTCATAT -3'

Sequencing Primer
(F):5'- GGCCATCCTCGTCTACAGAACTG -3'
(R):5'- CCTCAGCTGGGATTATAAGGC -3'
Posted On2016-11-08