Incidental Mutation 'R5514:Ddx55'
ID440230
Institutional Source Beutler Lab
Gene Symbol Ddx55
Ensembl Gene ENSMUSG00000029389
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Synonyms2810021H22Rik
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124552864-124569660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124556812 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 101 (V101A)
Ref Sequence ENSEMBL: ENSMUSP00000107065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071057] [ENSMUST00000111438] [ENSMUST00000131631]
Predicted Effect probably damaging
Transcript: ENSMUST00000071057
AA Change: V101A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070279
Gene: ENSMUSG00000029389
AA Change: V101A

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 402 465 1.44e-26 SMART
low complexity region 491 506 N/A INTRINSIC
low complexity region 517 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111438
AA Change: V101A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107065
Gene: ENSMUSG00000029389
AA Change: V101A

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 398 461 1.44e-26 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131631
SMART Domains Protein: ENSMUSP00000143462
Gene: ENSMUSG00000029389

DomainStartEndE-ValueType
Pfam:DEAD 33 125 6.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196021
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of protein family containing a characteristic Asp-Glu-Ala-Asp (DEAD) motif. These proteins are putative RNA helicases, and may be involved in a range of nuclear processes including translational initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Multiple alternatively spliced transcript variants have been found for this gene. Pseudogenes have been identified on chromosomes 1 and 12. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Prr5 C A 15: 84,702,895 P282Q probably benign Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Ddx55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Ddx55 APN 5 124567895 missense probably damaging 1.00
IGL03356:Ddx55 APN 5 124554753 missense possibly damaging 0.95
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0329:Ddx55 UTSW 5 124559147 missense probably benign 0.00
R0401:Ddx55 UTSW 5 124567951 missense probably damaging 1.00
R1604:Ddx55 UTSW 5 124559306 missense probably damaging 1.00
R1760:Ddx55 UTSW 5 124568113 missense probably damaging 0.99
R2002:Ddx55 UTSW 5 124566440 missense probably damaging 1.00
R2292:Ddx55 UTSW 5 124568077 missense probably benign 0.00
R4677:Ddx55 UTSW 5 124567934 missense probably benign 0.04
R4735:Ddx55 UTSW 5 124566476 missense probably damaging 1.00
R4745:Ddx55 UTSW 5 124566965 nonsense probably null
R4941:Ddx55 UTSW 5 124568716 nonsense probably null
R5272:Ddx55 UTSW 5 124558029 missense possibly damaging 0.91
R5348:Ddx55 UTSW 5 124554565 missense probably damaging 0.96
R5801:Ddx55 UTSW 5 124566497 critical splice donor site probably null
R5806:Ddx55 UTSW 5 124559199 missense probably damaging 1.00
R5869:Ddx55 UTSW 5 124568682 missense probably benign
R5909:Ddx55 UTSW 5 124566850 missense probably benign 0.00
R6594:Ddx55 UTSW 5 124566925 missense probably damaging 1.00
R6737:Ddx55 UTSW 5 124552945 missense probably damaging 1.00
R7257:Ddx55 UTSW 5 124560721 missense possibly damaging 0.67
R7262:Ddx55 UTSW 5 124566856 missense probably benign
R8049:Ddx55 UTSW 5 124556758 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGCTGGGCCTTGTTCAGAG -3'
(R):5'- TCCAATCCACAAAATCTGGCTG -3'

Sequencing Primer
(F):5'- CAAAGCTCTTGATTTGCTGAGACCG -3'
(R):5'- TCCACAAAATCTGGCTGAAAAGG -3'
Posted On2016-11-08