Mutagenetix > Incidental Mutation

Incidental Mutation 'R5514:Vmn2r68'

440236

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

043074-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R5514 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 85237559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 49 (T49I)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061074
AA Change: T49I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: T49I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam17	T	C	12: 21,340,519	S382G	probably damaging	Het
Agr2	G	A	12: 35,996,091	V74I	probably benign	Het
Aldh3a1	T	C	11: 61,218,041	S423P	probably damaging	Het
Ampd1	C	T	3: 103,079,172	H56Y	possibly damaging	Het
Arhgef2	C	A	3: 88,642,997	P670T	probably benign	Het
Blk	T	G	14: 63,378,481	D333A	probably damaging	Het
Bmi1	T	C	2: 18,681,903	I31T	probably damaging	Het
Cacna1d	G	A	14: 30,350,833	Q62*	probably null	Het
Ccdc88c	A	G	12: 100,913,439	S1801P	probably damaging	Het
Cdkal1	C	T	13: 29,777,287	A100T	probably damaging	Het
Chst4	G	T	8: 110,029,974	S419Y	probably damaging	Het
Cntn4	T	C	6: 106,672,883	I680T	probably damaging	Het
Ddx55	T	C	5: 124,556,812	V101A	probably damaging	Het
Ddx60	A	T	8: 61,958,057	E451V	probably damaging	Het
Dffa	T	A	4: 149,106,315		probably null	Het
Dgkd	A	G	1: 87,934,110	R796G	probably damaging	Het
Dzank1	T	A	2: 144,481,685	M614L	probably benign	Het
Elf2	G	T	3: 51,308,134	Q52K	probably damaging	Het
Fcamr	T	A	1: 130,814,056	L522Q	probably damaging	Het
Fscn2	T	C	11: 120,368,032	Y468H	probably damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Gm4787	A	G	12: 81,378,328	V352A	possibly damaging	Het
Gtsf1	T	C	15: 103,428,375	Q13R	probably benign	Het
Itpkb	G	A	1: 180,413,909	V715M	probably damaging	Het
Jmjd1c	T	A	10: 67,218,149	S263T	probably damaging	Het
Krba1	T	G	6: 48,413,495	L736R	probably damaging	Het
Lrrc8d	C	G	5: 105,812,784	F353L	probably damaging	Het
Lrrc8d	G	A	5: 105,812,785	E354K	probably benign	Het
Mtor	T	A	4: 148,546,444	V2286E	probably damaging	Het
Mybbp1a	T	A	11: 72,450,636	V1100E	possibly damaging	Het
Myo5a	G	A	9: 75,153,766	G518D	probably damaging	Het
Nalcn	A	T	14: 123,283,711	I1594N	probably benign	Het
Nav1	C	G	1: 135,470,561	G761A	probably benign	Het
Ncoa2	A	T	1: 13,181,221	L276H	probably damaging	Het
Ndufaf7	T	C	17: 78,937,622	Y57H	probably damaging	Het
Nfkb2	A	G	19: 46,311,408	Y807C	probably damaging	Het
Nid2	A	T	14: 19,802,467	Q1081L	probably damaging	Het
Nkain2	T	A	10: 31,951,193	I134F	probably damaging	Het
Nmu	A	C	5: 76,350,132	S69A	probably damaging	Het
Olfr1086	T	C	2: 86,676,881	I151V	probably benign	Het
Olfr1229	A	T	2: 89,282,473	I220N	probably damaging	Het
Pard3	A	G	8: 127,426,605	R886G	probably damaging	Het
Pde6b	G	T	5: 108,423,451	Q423H	probably benign	Het
Pip5k1b	A	T	19: 24,350,141	D450E	probably damaging	Het
Plcg1	T	C	2: 160,753,355		probably null	Het
Pnpt1	T	C	11: 29,153,246	S504P	possibly damaging	Het
Pomt2	A	T	12: 87,129,023	D312E	probably damaging	Het
Ppp1r1b	T	C	11: 98,355,402	L70P	probably damaging	Het
Prr5	C	A	15: 84,702,895	P282Q	probably benign	Het
Reln	A	T	5: 21,971,885	W1928R	possibly damaging	Het
Sacm1l	A	T	9: 123,586,354	R465*	probably null	Het
Sema7a	A	G	9: 57,955,763	Y239C	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Svep1	T	C	4: 58,044,054	T3531A	possibly damaging	Het
Tjp1	A	T	7: 65,354,861	W19R	probably damaging	Het
Tmc2	T	A	2: 130,241,644	M507K	possibly damaging	Het
Unc13a	A	G	8: 71,643,151	Y1241H	probably damaging	Het
Upp1	C	T	11: 9,131,771	P103S	probably damaging	Het
Vldlr	A	G	19: 27,244,224	E663G	probably damaging	Het
Wdr66	G	T	5: 123,287,766		probably null	Het
Xirp2	A	T	2: 67,505,121	M95L	probably benign	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GGTCAATACCGTGTATCATTCATTC -3'
(R):5'- AGGCAGATATCTTGCTGGC -3'

Sequencing Primer
(F):5'- CCGTGTATCATTCATTCAGCATTTAG -3'
(R):5'- GCTGGCAGGATAAAGATGTTCTC -3'

Posted On

2016-11-08