Mutagenetix > Incidental Mutations

Incidental Mutation 'R5514:Ddx60'

440237

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

043074-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R5514 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61958057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 451 (E451V)

Ref Sequence

ENSEMBL: ENSMUSP00000122841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]

AlphaFold

E9PZQ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000070631
AA Change: E451V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: E451V

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093485
AA Change: E451V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: E451V

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000154398
AA Change: E451V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: E451V

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam17	T	C	12: 21,340,519	S382G	probably damaging	Het
Agr2	G	A	12: 35,996,091	V74I	probably benign	Het
Aldh3a1	T	C	11: 61,218,041	S423P	probably damaging	Het
Ampd1	C	T	3: 103,079,172	H56Y	possibly damaging	Het
Arhgef2	C	A	3: 88,642,997	P670T	probably benign	Het
Blk	T	G	14: 63,378,481	D333A	probably damaging	Het
Bmi1	T	C	2: 18,681,903	I31T	probably damaging	Het
Cacna1d	G	A	14: 30,350,833	Q62*	probably null	Het
Ccdc88c	A	G	12: 100,913,439	S1801P	probably damaging	Het
Cdkal1	C	T	13: 29,777,287	A100T	probably damaging	Het
Chst4	G	T	8: 110,029,974	S419Y	probably damaging	Het
Cntn4	T	C	6: 106,672,883	I680T	probably damaging	Het
Ddx55	T	C	5: 124,556,812	V101A	probably damaging	Het
Dffa	T	A	4: 149,106,315		probably null	Het
Dgkd	A	G	1: 87,934,110	R796G	probably damaging	Het
Dzank1	T	A	2: 144,481,685	M614L	probably benign	Het
Elf2	G	T	3: 51,308,134	Q52K	probably damaging	Het
Fcamr	T	A	1: 130,814,056	L522Q	probably damaging	Het
Fscn2	T	C	11: 120,368,032	Y468H	probably damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Gm4787	A	G	12: 81,378,328	V352A	possibly damaging	Het
Gtsf1	T	C	15: 103,428,375	Q13R	probably benign	Het
Itpkb	G	A	1: 180,413,909	V715M	probably damaging	Het
Jmjd1c	T	A	10: 67,218,149	S263T	probably damaging	Het
Krba1	T	G	6: 48,413,495	L736R	probably damaging	Het
Lrrc8d	C	G	5: 105,812,784	F353L	probably damaging	Het
Lrrc8d	G	A	5: 105,812,785	E354K	probably benign	Het
Mtor	T	A	4: 148,546,444	V2286E	probably damaging	Het
Mybbp1a	T	A	11: 72,450,636	V1100E	possibly damaging	Het
Myo5a	G	A	9: 75,153,766	G518D	probably damaging	Het
Nalcn	A	T	14: 123,283,711	I1594N	probably benign	Het
Nav1	C	G	1: 135,470,561	G761A	probably benign	Het
Ncoa2	A	T	1: 13,181,221	L276H	probably damaging	Het
Ndufaf7	T	C	17: 78,937,622	Y57H	probably damaging	Het
Nfkb2	A	G	19: 46,311,408	Y807C	probably damaging	Het
Nid2	A	T	14: 19,802,467	Q1081L	probably damaging	Het
Nkain2	T	A	10: 31,951,193	I134F	probably damaging	Het
Nmu	A	C	5: 76,350,132	S69A	probably damaging	Het
Olfr1086	T	C	2: 86,676,881	I151V	probably benign	Het
Olfr1229	A	T	2: 89,282,473	I220N	probably damaging	Het
Pard3	A	G	8: 127,426,605	R886G	probably damaging	Het
Pde6b	G	T	5: 108,423,451	Q423H	probably benign	Het
Pip5k1b	A	T	19: 24,350,141	D450E	probably damaging	Het
Plcg1	T	C	2: 160,753,355		probably null	Het
Pnpt1	T	C	11: 29,153,246	S504P	possibly damaging	Het
Pomt2	A	T	12: 87,129,023	D312E	probably damaging	Het
Ppp1r1b	T	C	11: 98,355,402	L70P	probably damaging	Het
Prr5	C	A	15: 84,702,895	P282Q	probably benign	Het
Reln	A	T	5: 21,971,885	W1928R	possibly damaging	Het
Sacm1l	A	T	9: 123,586,354	R465*	probably null	Het
Sema7a	A	G	9: 57,955,763	Y239C	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Svep1	T	C	4: 58,044,054	T3531A	possibly damaging	Het
Tjp1	A	T	7: 65,354,861	W19R	probably damaging	Het
Tmc2	T	A	2: 130,241,644	M507K	possibly damaging	Het
Unc13a	A	G	8: 71,643,151	Y1241H	probably damaging	Het
Upp1	C	T	11: 9,131,771	P103S	probably damaging	Het
Vldlr	A	G	19: 27,244,224	E663G	probably damaging	Het
Vmn2r68	G	A	7: 85,237,559	T49I	possibly damaging	Het
Wdr66	G	T	5: 123,287,766		probably null	Het
Xirp2	A	T	2: 67,505,121	M95L	probably benign	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GTTCCAAAAGACTCAATGTGGG -3'
(R):5'- GTCTTCAACACTCAAACATTGCTTG -3'

Sequencing Primer
(F):5'- CAATGTGGGAAATAGTTTTATGTGC -3'
(R):5'- GATGTCATAAAGAAGGTCAACAGAC -3'

Posted On

2016-11-08