Incidental Mutation 'R5514:Mybbp1a'
ID 440249
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene Name MYB binding protein (P160) 1a
Synonyms p67MBP, p160MBP
MMRRC Submission 043074-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5514 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 72332181-72342594 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72341462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1100 (V1100E)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303] [ENSMUST00000045633]
AlphaFold Q7TPV4
Predicted Effect probably benign
Transcript: ENSMUST00000045303
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045633
AA Change: V1100E

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: V1100E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150491
Predicted Effect probably benign
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,390,520 (GRCm39) S382G probably damaging Het
Agr2 G A 12: 36,046,090 (GRCm39) V74I probably benign Het
Aldh3a1 T C 11: 61,108,867 (GRCm39) S423P probably damaging Het
Ampd1 C T 3: 102,986,488 (GRCm39) H56Y possibly damaging Het
Arhgef2 C A 3: 88,550,304 (GRCm39) P670T probably benign Het
Blk T G 14: 63,615,930 (GRCm39) D333A probably damaging Het
Bmi1 T C 2: 18,686,714 (GRCm39) I31T probably damaging Het
Cacna1d G A 14: 30,072,790 (GRCm39) Q62* probably null Het
Ccdc88c A G 12: 100,879,698 (GRCm39) S1801P probably damaging Het
Cdkal1 C T 13: 29,961,270 (GRCm39) A100T probably damaging Het
Cfap251 G T 5: 123,425,829 (GRCm39) probably null Het
Chst4 G T 8: 110,756,606 (GRCm39) S419Y probably damaging Het
Cntn4 T C 6: 106,649,844 (GRCm39) I680T probably damaging Het
Ddx55 T C 5: 124,694,875 (GRCm39) V101A probably damaging Het
Ddx60 A T 8: 62,411,091 (GRCm39) E451V probably damaging Het
Dffa T A 4: 149,190,772 (GRCm39) probably null Het
Dgkd A G 1: 87,861,832 (GRCm39) R796G probably damaging Het
Dzank1 T A 2: 144,323,605 (GRCm39) M614L probably benign Het
Elf2 G T 3: 51,215,555 (GRCm39) Q52K probably damaging Het
Fcamr T A 1: 130,741,793 (GRCm39) L522Q probably damaging Het
Fscn2 T C 11: 120,258,858 (GRCm39) Y468H probably damaging Het
Gm12689 T C 4: 99,184,402 (GRCm39) I85T unknown Het
Gm4787 A G 12: 81,425,102 (GRCm39) V352A possibly damaging Het
Gtsf1 T C 15: 103,336,802 (GRCm39) Q13R probably benign Het
Itpkb G A 1: 180,241,474 (GRCm39) V715M probably damaging Het
Jmjd1c T A 10: 67,053,928 (GRCm39) S263T probably damaging Het
Krba1 T G 6: 48,390,429 (GRCm39) L736R probably damaging Het
Lrrc8d C G 5: 105,960,650 (GRCm39) F353L probably damaging Het
Lrrc8d G A 5: 105,960,651 (GRCm39) E354K probably benign Het
Mtor T A 4: 148,630,901 (GRCm39) V2286E probably damaging Het
Myo5a G A 9: 75,061,048 (GRCm39) G518D probably damaging Het
Nalcn A T 14: 123,521,123 (GRCm39) I1594N probably benign Het
Nav1 C G 1: 135,398,299 (GRCm39) G761A probably benign Het
Ncoa2 A T 1: 13,251,445 (GRCm39) L276H probably damaging Het
Ndufaf7 T C 17: 79,245,051 (GRCm39) Y57H probably damaging Het
Nfkb2 A G 19: 46,299,847 (GRCm39) Y807C probably damaging Het
Nid2 A T 14: 19,852,535 (GRCm39) Q1081L probably damaging Het
Nkain2 T A 10: 31,827,189 (GRCm39) I134F probably damaging Het
Nmu A C 5: 76,497,979 (GRCm39) S69A probably damaging Het
Or4c15b A T 2: 89,112,817 (GRCm39) I220N probably damaging Het
Or5t7 T C 2: 86,507,225 (GRCm39) I151V probably benign Het
Pard3 A G 8: 128,153,086 (GRCm39) R886G probably damaging Het
Pde6b G T 5: 108,571,317 (GRCm39) Q423H probably benign Het
Pip5k1b A T 19: 24,327,505 (GRCm39) D450E probably damaging Het
Plcg1 T C 2: 160,595,275 (GRCm39) probably null Het
Pnpt1 T C 11: 29,103,246 (GRCm39) S504P possibly damaging Het
Pomt2 A T 12: 87,175,797 (GRCm39) D312E probably damaging Het
Ppp1r1b T C 11: 98,246,228 (GRCm39) L70P probably damaging Het
Prr5 C A 15: 84,587,096 (GRCm39) P282Q probably benign Het
Reln A T 5: 22,176,883 (GRCm39) W1928R possibly damaging Het
Sacm1l A T 9: 123,415,419 (GRCm39) R465* probably null Het
Sema7a A G 9: 57,863,046 (GRCm39) Y239C probably damaging Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Svep1 T C 4: 58,044,054 (GRCm39) T3531A possibly damaging Het
Tjp1 A T 7: 65,004,609 (GRCm39) W19R probably damaging Het
Tmc2 T A 2: 130,083,564 (GRCm39) M507K possibly damaging Het
Unc13a A G 8: 72,095,795 (GRCm39) Y1241H probably damaging Het
Upp1 C T 11: 9,081,771 (GRCm39) P103S probably damaging Het
Vldlr A G 19: 27,221,624 (GRCm39) E663G probably damaging Het
Vmn2r68 G A 7: 84,886,767 (GRCm39) T49I possibly damaging Het
Xirp2 A T 2: 67,335,465 (GRCm39) M95L probably benign Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72,334,393 (GRCm39) missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72,336,492 (GRCm39) missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72,334,744 (GRCm39) splice site probably benign
IGL03344:Mybbp1a APN 11 72,336,028 (GRCm39) missense probably damaging 1.00
fratelli UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
primi UTSW 11 72,333,727 (GRCm39) splice site probably null
sorelli UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72,340,933 (GRCm39) splice site probably null
R0437:Mybbp1a UTSW 11 72,339,674 (GRCm39) missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72,339,202 (GRCm39) missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72,334,474 (GRCm39) missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72,336,043 (GRCm39) missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72,332,271 (GRCm39) missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72,337,021 (GRCm39) missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72,339,563 (GRCm39) missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72,337,996 (GRCm39) missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72,342,113 (GRCm39) missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72,338,797 (GRCm39) missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72,336,466 (GRCm39) missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72,336,040 (GRCm39) missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72,338,939 (GRCm39) missense probably damaging 0.99
R5548:Mybbp1a UTSW 11 72,336,998 (GRCm39) missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72,335,751 (GRCm39) missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72,333,257 (GRCm39) missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72,336,838 (GRCm39) missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72,338,392 (GRCm39) missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72,338,468 (GRCm39) splice site probably null
R7227:Mybbp1a UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72,334,338 (GRCm39) missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72,342,101 (GRCm39) missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72,333,727 (GRCm39) splice site probably null
R8213:Mybbp1a UTSW 11 72,335,547 (GRCm39) missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72,336,114 (GRCm39) critical splice donor site probably null
R8474:Mybbp1a UTSW 11 72,338,563 (GRCm39) missense probably benign 0.01
R8972:Mybbp1a UTSW 11 72,337,076 (GRCm39) missense probably benign 0.35
R9018:Mybbp1a UTSW 11 72,334,420 (GRCm39) missense probably benign 0.09
R9380:Mybbp1a UTSW 11 72,333,668 (GRCm39) missense probably benign 0.24
R9505:Mybbp1a UTSW 11 72,339,897 (GRCm39) missense probably benign 0.26
X0050:Mybbp1a UTSW 11 72,332,503 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGGTGGCTGAAGAACTAC -3'
(R):5'- TTAGCCACATGCCCAATGC -3'

Sequencing Primer
(F):5'- CAGGACCCTGGCTATGGAATG -3'
(R):5'- ACATGCCCAATGCTGGTC -3'
Posted On 2016-11-08