Mutagenetix > Incidental Mutation

Incidental Mutation 'R5514:Ccdc88c'

440257

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88c

Ensembl Gene

ENSMUSG00000021182

Gene Name

coiled-coil domain containing 88C

Synonyms

0610010D24Rik, Daple

MMRRC Submission

043074-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5514 (G1)

Quality Score

212

Status

Not validated

Chromosome

Chromosomal Location

100911523-101029056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100913439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1801 (S1801P)

Ref Sequence

ENSEMBL: ENSMUSP00000068629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096]

AlphaFold

Q6VGS5

Predicted Effect

probably damaging
Transcript: ENSMUST00000068411
AA Change: S1801P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: S1801P

Domain	Start	End	E-Value	Type
Pfam:HOOK	7	586	5.9e-37	PFAM
low complexity region	601	613	N/A	INTRINSIC
low complexity region	617	634	N/A	INTRINSIC
Blast:BRLZ	668	719	3e-8	BLAST
low complexity region	724	744	N/A	INTRINSIC
low complexity region	827	837	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
Blast:BRLZ	948	1007	6e-15	BLAST
coiled coil region	1035	1085	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
coiled coil region	1129	1252	N/A	INTRINSIC
coiled coil region	1312	1384	N/A	INTRINSIC
low complexity region	1430	1439	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
low complexity region	1698	1709	N/A	INTRINSIC
internal_repeat_1	1721	1778	6.97e-6	PROSPERO
low complexity region	1788	1808	N/A	INTRINSIC
internal_repeat_1	1934	1989	6.97e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000085096
AA Change: S1808P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: S1808P

Domain	Start	End	E-Value	Type
Pfam:HOOK	13	597	2.5e-41	PFAM
low complexity region	608	620	N/A	INTRINSIC
low complexity region	624	641	N/A	INTRINSIC
Blast:BRLZ	675	726	3e-8	BLAST
low complexity region	731	751	N/A	INTRINSIC
low complexity region	834	844	N/A	INTRINSIC
low complexity region	854	873	N/A	INTRINSIC
Blast:BRLZ	955	1014	5e-15	BLAST
coiled coil region	1042	1092	N/A	INTRINSIC
low complexity region	1102	1117	N/A	INTRINSIC
coiled coil region	1136	1259	N/A	INTRINSIC
coiled coil region	1319	1391	N/A	INTRINSIC
low complexity region	1437	1446	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1569	1590	N/A	INTRINSIC
low complexity region	1705	1716	N/A	INTRINSIC
internal_repeat_1	1728	1785	6.57e-6	PROSPERO
low complexity region	1795	1815	N/A	INTRINSIC
internal_repeat_1	1941	1996	6.57e-6	PROSPERO

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam17	T	C	12: 21,340,519	S382G	probably damaging	Het
Agr2	G	A	12: 35,996,091	V74I	probably benign	Het
Aldh3a1	T	C	11: 61,218,041	S423P	probably damaging	Het
Ampd1	C	T	3: 103,079,172	H56Y	possibly damaging	Het
Arhgef2	C	A	3: 88,642,997	P670T	probably benign	Het
Blk	T	G	14: 63,378,481	D333A	probably damaging	Het
Bmi1	T	C	2: 18,681,903	I31T	probably damaging	Het
Cacna1d	G	A	14: 30,350,833	Q62*	probably null	Het
Cdkal1	C	T	13: 29,777,287	A100T	probably damaging	Het
Chst4	G	T	8: 110,029,974	S419Y	probably damaging	Het
Cntn4	T	C	6: 106,672,883	I680T	probably damaging	Het
Ddx55	T	C	5: 124,556,812	V101A	probably damaging	Het
Ddx60	A	T	8: 61,958,057	E451V	probably damaging	Het
Dffa	T	A	4: 149,106,315		probably null	Het
Dgkd	A	G	1: 87,934,110	R796G	probably damaging	Het
Dzank1	T	A	2: 144,481,685	M614L	probably benign	Het
Elf2	G	T	3: 51,308,134	Q52K	probably damaging	Het
Fcamr	T	A	1: 130,814,056	L522Q	probably damaging	Het
Fscn2	T	C	11: 120,368,032	Y468H	probably damaging	Het
Gm12689	T	C	4: 99,296,165	I85T	unknown	Het
Gm4787	A	G	12: 81,378,328	V352A	possibly damaging	Het
Gtsf1	T	C	15: 103,428,375	Q13R	probably benign	Het
Itpkb	G	A	1: 180,413,909	V715M	probably damaging	Het
Jmjd1c	T	A	10: 67,218,149	S263T	probably damaging	Het
Krba1	T	G	6: 48,413,495	L736R	probably damaging	Het
Lrrc8d	C	G	5: 105,812,784	F353L	probably damaging	Het
Lrrc8d	G	A	5: 105,812,785	E354K	probably benign	Het
Mtor	T	A	4: 148,546,444	V2286E	probably damaging	Het
Mybbp1a	T	A	11: 72,450,636	V1100E	possibly damaging	Het
Myo5a	G	A	9: 75,153,766	G518D	probably damaging	Het
Nalcn	A	T	14: 123,283,711	I1594N	probably benign	Het
Nav1	C	G	1: 135,470,561	G761A	probably benign	Het
Ncoa2	A	T	1: 13,181,221	L276H	probably damaging	Het
Ndufaf7	T	C	17: 78,937,622	Y57H	probably damaging	Het
Nfkb2	A	G	19: 46,311,408	Y807C	probably damaging	Het
Nid2	A	T	14: 19,802,467	Q1081L	probably damaging	Het
Nkain2	T	A	10: 31,951,193	I134F	probably damaging	Het
Nmu	A	C	5: 76,350,132	S69A	probably damaging	Het
Olfr1086	T	C	2: 86,676,881	I151V	probably benign	Het
Olfr1229	A	T	2: 89,282,473	I220N	probably damaging	Het
Pard3	A	G	8: 127,426,605	R886G	probably damaging	Het
Pde6b	G	T	5: 108,423,451	Q423H	probably benign	Het
Pip5k1b	A	T	19: 24,350,141	D450E	probably damaging	Het
Plcg1	T	C	2: 160,753,355		probably null	Het
Pnpt1	T	C	11: 29,153,246	S504P	possibly damaging	Het
Pomt2	A	T	12: 87,129,023	D312E	probably damaging	Het
Ppp1r1b	T	C	11: 98,355,402	L70P	probably damaging	Het
Prr5	C	A	15: 84,702,895	P282Q	probably benign	Het
Reln	A	T	5: 21,971,885	W1928R	possibly damaging	Het
Sacm1l	A	T	9: 123,586,354	R465*	probably null	Het
Sema7a	A	G	9: 57,955,763	Y239C	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Svep1	T	C	4: 58,044,054	T3531A	possibly damaging	Het
Tjp1	A	T	7: 65,354,861	W19R	probably damaging	Het
Tmc2	T	A	2: 130,241,644	M507K	possibly damaging	Het
Unc13a	A	G	8: 71,643,151	Y1241H	probably damaging	Het
Upp1	C	T	11: 9,131,771	P103S	probably damaging	Het
Vldlr	A	G	19: 27,244,224	E663G	probably damaging	Het
Vmn2r68	G	A	7: 85,237,559	T49I	possibly damaging	Het
Wdr66	G	T	5: 123,287,766		probably null	Het
Xirp2	A	T	2: 67,505,121	M95L	probably benign	Het

Other mutations in Ccdc88c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01112:Ccdc88c	APN	12	100916803	missense	probably benign	0.04
IGL02016:Ccdc88c	APN	12	100941207	missense	possibly damaging	0.63
IGL02031:Ccdc88c	APN	12	100933311	missense	probably damaging	0.98
IGL02133:Ccdc88c	APN	12	100940090	missense	probably damaging	1.00
IGL02427:Ccdc88c	APN	12	100921592	missense	probably damaging	1.00
IGL02494:Ccdc88c	APN	12	100945475	missense	probably benign
IGL02496:Ccdc88c	APN	12	100953293	missense	probably benign	0.05
IGL02549:Ccdc88c	APN	12	100928932	missense	probably benign	0.18
IGL02618:Ccdc88c	APN	12	100913553	missense	probably benign	0.28
IGL02626:Ccdc88c	APN	12	100967800	unclassified	probably benign
IGL03142:Ccdc88c	APN	12	100947198	missense	probably damaging	1.00
BB010:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
BB020:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R0127:Ccdc88c	UTSW	12	100935740	missense	possibly damaging	0.88
R0533:Ccdc88c	UTSW	12	100954282	missense	probably damaging	1.00
R0545:Ccdc88c	UTSW	12	100947188	missense	probably damaging	1.00
R0866:Ccdc88c	UTSW	12	100913192	missense	probably benign	0.01
R1230:Ccdc88c	UTSW	12	100948488	missense	probably benign	0.00
R1434:Ccdc88c	UTSW	12	100939166	splice site	probably benign
R1614:Ccdc88c	UTSW	12	100912984	missense	probably benign	0.00
R1644:Ccdc88c	UTSW	12	100913474	missense	probably damaging	0.98
R1712:Ccdc88c	UTSW	12	100939025	missense	probably benign	0.14
R2107:Ccdc88c	UTSW	12	100921549	missense	probably benign
R3612:Ccdc88c	UTSW	12	100939073	missense	probably damaging	0.99
R3724:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3737:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3743:Ccdc88c	UTSW	12	100948584	missense	probably damaging	1.00
R3772:Ccdc88c	UTSW	12	100966100	unclassified	probably benign
R3776:Ccdc88c	UTSW	12	100947179	missense	probably damaging	0.97
R3917:Ccdc88c	UTSW	12	100941107	critical splice donor site	probably null
R4034:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4035:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4110:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4113:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4270:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4271:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4520:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4521:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4522:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4523:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4524:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4717:Ccdc88c	UTSW	12	100916666	missense	probably benign	0.00
R4821:Ccdc88c	UTSW	12	100938079	missense	probably benign	0.00
R4823:Ccdc88c	UTSW	12	100930543	missense	probably damaging	1.00
R5090:Ccdc88c	UTSW	12	100954180	missense	probably damaging	1.00
R5510:Ccdc88c	UTSW	12	100945031	missense	probably damaging	1.00
R5903:Ccdc88c	UTSW	12	100930542	missense	probably damaging	1.00
R5999:Ccdc88c	UTSW	12	100968354	missense	probably damaging	1.00
R6131:Ccdc88c	UTSW	12	100941128	missense	probably damaging	1.00
R6164:Ccdc88c	UTSW	12	100953383	missense	probably damaging	0.98
R6971:Ccdc88c	UTSW	12	100954227	missense	probably damaging	1.00
R6998:Ccdc88c	UTSW	12	100916852	missense	probably damaging	0.96
R7031:Ccdc88c	UTSW	12	100945064	missense	probably damaging	1.00
R7240:Ccdc88c	UTSW	12	100944939	missense	probably benign	0.17
R7366:Ccdc88c	UTSW	12	100944950	missense	possibly damaging	0.89
R7604:Ccdc88c	UTSW	12	100930547	missense	probably damaging	1.00
R7674:Ccdc88c	UTSW	12	100945232	missense	probably benign	0.00
R7795:Ccdc88c	UTSW	12	100923311	missense	probably benign	0.32
R7933:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R7990:Ccdc88c	UTSW	12	100967985	missense	probably damaging	1.00
R8339:Ccdc88c	UTSW	12	100941140	nonsense	probably null
R8734:Ccdc88c	UTSW	12	100940135	missense	probably damaging	1.00
R8778:Ccdc88c	UTSW	12	100945224	missense	probably benign	0.25
R8925:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R8927:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R9014:Ccdc88c	UTSW	12	100913064	missense	probably benign	0.09
R9204:Ccdc88c	UTSW	12	100938063	missense	unknown
R9257:Ccdc88c	UTSW	12	100923215	missense	possibly damaging	0.94
R9326:Ccdc88c	UTSW	12	101028850	start gained	probably benign
R9424:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R9439:Ccdc88c	UTSW	12	100918338	missense	probably benign	0.25
R9539:Ccdc88c	UTSW	12	100935734	missense	possibly damaging	0.89
R9576:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
Z1176:Ccdc88c	UTSW	12	100945770	missense	possibly damaging	0.69
Z1177:Ccdc88c	UTSW	12	100945155	missense	probably benign
Z1190:Ccdc88c	UTSW	12	100923332	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCGTCTTGTGTCCAGTGG -3'
(R):5'- GGCATTATGTAAAGCCCAACC -3'

Sequencing Primer
(F):5'- TGGCCTGGAGAGGGACTG -3'
(R):5'- TTATGTAAAGCCCAACCTGAGAC -3'

Posted On

2016-11-08