Incidental Mutation 'R5514:Prr5'
ID440263
Institutional Source Beutler Lab
Gene Symbol Prr5
Ensembl Gene ENSMUSG00000036106
Gene Nameproline rich 5 (renal)
SynonymsC030017C09Rik, Protor-1
MMRRC Submission 043074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5514 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84669620-84703673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84702895 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 282 (P282Q)
Ref Sequence ENSEMBL: ENSMUSP00000127890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065499] [ENSMUST00000171460]
Predicted Effect probably benign
Transcript: ENSMUST00000065499
AA Change: P291Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066396
Gene: ENSMUSG00000036106
AA Change: P291Q

DomainStartEndE-ValueType
Pfam:HbrB 38 144 6.9e-17 PFAM
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171460
AA Change: P282Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127890
Gene: ENSMUSG00000036106
AA Change: P282Q

DomainStartEndE-ValueType
Pfam:HbrB 27 159 1.3e-36 PFAM
low complexity region 324 335 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 T C 12: 21,340,519 S382G probably damaging Het
Agr2 G A 12: 35,996,091 V74I probably benign Het
Aldh3a1 T C 11: 61,218,041 S423P probably damaging Het
Ampd1 C T 3: 103,079,172 H56Y possibly damaging Het
Arhgef2 C A 3: 88,642,997 P670T probably benign Het
Blk T G 14: 63,378,481 D333A probably damaging Het
Bmi1 T C 2: 18,681,903 I31T probably damaging Het
Cacna1d G A 14: 30,350,833 Q62* probably null Het
Ccdc88c A G 12: 100,913,439 S1801P probably damaging Het
Cdkal1 C T 13: 29,777,287 A100T probably damaging Het
Chst4 G T 8: 110,029,974 S419Y probably damaging Het
Cntn4 T C 6: 106,672,883 I680T probably damaging Het
Ddx55 T C 5: 124,556,812 V101A probably damaging Het
Ddx60 A T 8: 61,958,057 E451V probably damaging Het
Dffa T A 4: 149,106,315 probably null Het
Dgkd A G 1: 87,934,110 R796G probably damaging Het
Dzank1 T A 2: 144,481,685 M614L probably benign Het
Elf2 G T 3: 51,308,134 Q52K probably damaging Het
Fcamr T A 1: 130,814,056 L522Q probably damaging Het
Fscn2 T C 11: 120,368,032 Y468H probably damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm4787 A G 12: 81,378,328 V352A possibly damaging Het
Gtsf1 T C 15: 103,428,375 Q13R probably benign Het
Itpkb G A 1: 180,413,909 V715M probably damaging Het
Jmjd1c T A 10: 67,218,149 S263T probably damaging Het
Krba1 T G 6: 48,413,495 L736R probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mtor T A 4: 148,546,444 V2286E probably damaging Het
Mybbp1a T A 11: 72,450,636 V1100E possibly damaging Het
Myo5a G A 9: 75,153,766 G518D probably damaging Het
Nalcn A T 14: 123,283,711 I1594N probably benign Het
Nav1 C G 1: 135,470,561 G761A probably benign Het
Ncoa2 A T 1: 13,181,221 L276H probably damaging Het
Ndufaf7 T C 17: 78,937,622 Y57H probably damaging Het
Nfkb2 A G 19: 46,311,408 Y807C probably damaging Het
Nid2 A T 14: 19,802,467 Q1081L probably damaging Het
Nkain2 T A 10: 31,951,193 I134F probably damaging Het
Nmu A C 5: 76,350,132 S69A probably damaging Het
Olfr1086 T C 2: 86,676,881 I151V probably benign Het
Olfr1229 A T 2: 89,282,473 I220N probably damaging Het
Pard3 A G 8: 127,426,605 R886G probably damaging Het
Pde6b G T 5: 108,423,451 Q423H probably benign Het
Pip5k1b A T 19: 24,350,141 D450E probably damaging Het
Plcg1 T C 2: 160,753,355 probably null Het
Pnpt1 T C 11: 29,153,246 S504P possibly damaging Het
Pomt2 A T 12: 87,129,023 D312E probably damaging Het
Ppp1r1b T C 11: 98,355,402 L70P probably damaging Het
Reln A T 5: 21,971,885 W1928R possibly damaging Het
Sacm1l A T 9: 123,586,354 R465* probably null Het
Sema7a A G 9: 57,955,763 Y239C probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svep1 T C 4: 58,044,054 T3531A possibly damaging Het
Tjp1 A T 7: 65,354,861 W19R probably damaging Het
Tmc2 T A 2: 130,241,644 M507K possibly damaging Het
Unc13a A G 8: 71,643,151 Y1241H probably damaging Het
Upp1 C T 11: 9,131,771 P103S probably damaging Het
Vldlr A G 19: 27,244,224 E663G probably damaging Het
Vmn2r68 G A 7: 85,237,559 T49I possibly damaging Het
Wdr66 G T 5: 123,287,766 probably null Het
Xirp2 A T 2: 67,505,121 M95L probably benign Het
Other mutations in Prr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prr5 APN 15 84699655 missense possibly damaging 0.47
IGL02656:Prr5 APN 15 84699136 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0389:Prr5 UTSW 15 84702951 missense probably benign 0.00
R0514:Prr5 UTSW 15 84702766 missense probably benign 0.19
R1414:Prr5 UTSW 15 84699711 nonsense probably null
R2027:Prr5 UTSW 15 84701379 missense probably damaging 0.99
R2230:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2231:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2232:Prr5 UTSW 15 84702780 missense probably benign 0.15
R3498:Prr5 UTSW 15 84703144 missense probably benign 0.12
R3791:Prr5 UTSW 15 84681216 missense probably damaging 1.00
R3910:Prr5 UTSW 15 84703144 missense probably benign 0.12
R5911:Prr5 UTSW 15 84701434 nonsense probably null
R6085:Prr5 UTSW 15 84687905 missense probably damaging 1.00
R6187:Prr5 UTSW 15 84693772 missense probably damaging 1.00
R6394:Prr5 UTSW 15 84699724 missense probably damaging 0.99
R6422:Prr5 UTSW 15 84693804 missense probably damaging 1.00
R6631:Prr5 UTSW 15 84702777 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCCACCATCTTAGTGTATG -3'
(R):5'- GGATCTGGTCCACAAGAGTC -3'

Sequencing Primer
(F):5'- TCTGTTCCTGCAGAGAAACG -3'
(R):5'- ATCTGGTCCACAAGAGTCTCTGG -3'
Posted On2016-11-08