Incidental Mutation 'R5610:CK137956'
ID440284
Institutional Source Beutler Lab
Gene Symbol CK137956
Ensembl Gene ENSMUSG00000028813
Gene NamecDNA sequence CK137956
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5610 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127927592-127970951 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 127946647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030614]
Predicted Effect probably null
Transcript: ENSMUST00000030614
SMART Domains Protein: ENSMUSP00000030614
Gene: ENSMUSG00000028813

DomainStartEndE-ValueType
Pfam:DUF4688 197 596 3.8e-249 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,931,019 V318I probably benign Het
1700018F24Rik A G 5: 145,045,346 D247G possibly damaging Het
1700123K08Rik A G 5: 138,564,141 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Accsl C A 2: 93,861,773 probably null Het
Adad2 C T 8: 119,614,761 R171C probably benign Het
Adgrv1 A C 13: 81,521,117 L2440R probably damaging Het
Antxr1 A G 6: 87,255,863 V239A probably damaging Het
Arhgap28 G A 17: 67,896,240 Q73* probably null Het
Arrdc5 C T 17: 56,297,846 R147H probably benign Het
Ash1l T C 3: 89,023,185 Y1990H probably damaging Het
Bank1 T C 3: 136,066,387 E494G probably damaging Het
Bicral A T 17: 46,808,492 I701N probably damaging Het
Bod1l T C 5: 41,821,874 Y699C probably damaging Het
C3ar1 T G 6: 122,850,578 T227P probably benign Het
Ccr3 C A 9: 124,029,481 D284E probably damaging Het
Cdh13 T C 8: 118,851,723 V163A possibly damaging Het
Cltc T C 11: 86,721,646 S529G probably benign Het
Ddx11 A G 17: 66,150,026 K783E probably damaging Het
Dnah3 T A 7: 119,939,065 probably null Het
Eef2k A G 7: 120,886,782 H408R probably benign Het
Esr1 A G 10: 5,001,221 K533R probably damaging Het
Fat1 T A 8: 44,953,072 Y953* probably null Het
Fosl1 T A 19: 5,455,105 probably null Het
Frmd4b A G 6: 97,306,791 M373T probably benign Het
Gm1968 A G 16: 29,958,739 noncoding transcript Het
Gpr26 T C 7: 131,966,965 V13A possibly damaging Het
Gtf3c1 T C 7: 125,703,945 N106S possibly damaging Het
Itgb8 T G 12: 119,170,694 E546A probably damaging Het
Itpr3 C T 17: 27,118,566 T2450M probably benign Het
Kif1a A T 1: 93,025,728 Y1245N probably damaging Het
Klrb1f G A 6: 129,054,372 probably null Het
Lars A G 18: 42,257,091 L37P probably benign Het
Lnpk T C 2: 74,548,025 T131A probably benign Het
Mob3c C T 4: 115,833,681 T156I probably benign Het
Nadk T A 4: 155,584,171 W100R probably damaging Het
Npy6r A T 18: 44,275,994 I161F probably benign Het
Olfr1212 A C 2: 88,958,826 D120A probably damaging Het
Olfr773 G A 10: 129,186,557 T288I probably damaging Het
Pcdhga3 A G 18: 37,675,223 E243G possibly damaging Het
Pdss2 A G 10: 43,439,832 T361A probably benign Het
Pkd1l2 G T 8: 117,042,320 Q1198K probably benign Het
Prdx1 T A 4: 116,692,927 I102N probably damaging Het
Prss1 G A 6: 41,461,213 V25I probably benign Het
Pspc1 A G 14: 56,777,931 Y77H probably damaging Het
Rnf5 T C 17: 34,601,738 probably benign Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Ryr1 C A 7: 29,111,974 M235I probably benign Het
Sec24c A G 14: 20,691,825 Y776C probably damaging Het
Sharpin A G 15: 76,350,053 probably null Het
Slc12a4 C A 8: 105,950,213 V482L possibly damaging Het
Slc38a1 C T 15: 96,616,141 probably null Het
Smtn G T 11: 3,529,582 T495N probably damaging Het
Sncaip A G 18: 52,868,919 T171A probably benign Het
Sprr2e T C 3: 92,353,092 *77R probably null Het
Syngap1 T A 17: 26,959,780 D443E possibly damaging Het
Taldo1 T C 7: 141,392,292 V24A probably damaging Het
Tfap2c T A 2: 172,549,858 N8K probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Tubgcp3 T C 8: 12,639,577 Y563C probably damaging Het
Ubr1 T A 2: 120,892,112 D1342V probably benign Het
Usp7 C T 16: 8,716,510 probably null Het
Wbp1 C T 6: 83,120,235 G75D probably damaging Het
Zfp180 G T 7: 24,104,890 V245F probably benign Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp646 T A 7: 127,879,358 C236S probably damaging Het
Other mutations in CK137956
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:CK137956 APN 4 127935850 missense probably benign
IGL01365:CK137956 APN 4 127951342 missense probably benign 0.01
IGL01563:CK137956 APN 4 127970635 missense possibly damaging 0.94
IGL01834:CK137956 APN 4 127946649 missense probably damaging 1.00
R0117:CK137956 UTSW 4 127946792 missense possibly damaging 0.63
R0456:CK137956 UTSW 4 127945307 missense probably damaging 0.99
R0492:CK137956 UTSW 4 127951300 missense probably benign 0.03
R1793:CK137956 UTSW 4 127951449 missense probably benign
R1869:CK137956 UTSW 4 127970534 missense possibly damaging 0.92
R1932:CK137956 UTSW 4 127946858 missense possibly damaging 0.89
R2011:CK137956 UTSW 4 127951036 missense probably benign 0.25
R2030:CK137956 UTSW 4 127951387 missense probably benign 0.23
R2032:CK137956 UTSW 4 127945276 missense probably benign 0.38
R2135:CK137956 UTSW 4 127951640 splice site probably benign
R2994:CK137956 UTSW 4 127951507 missense probably benign 0.03
R3608:CK137956 UTSW 4 127951326 missense probably damaging 1.00
R3895:CK137956 UTSW 4 127946648 missense probably benign 0.01
R4165:CK137956 UTSW 4 127970729 missense possibly damaging 0.83
R6861:CK137956 UTSW 4 127970726 missense probably damaging 0.98
R7149:CK137956 UTSW 4 127970833 start codon destroyed probably null 0.53
R8132:CK137956 UTSW 4 127951282 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTGGGATCTCTGAAAAC -3'
(R):5'- AGCCTCTTTCTCAACCAGTGG -3'

Sequencing Primer
(F):5'- CTGTGGGATCTCTGAAAACCAATTAC -3'
(R):5'- TTCTCAACCAGTGGCCCCAG -3'
Posted On2016-11-08