Incidental Mutation 'R5610:C3ar1'
ID440297
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5610 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122850578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 227 (T227P)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042081]
Predicted Effect probably benign
Transcript: ENSMUST00000042081
AA Change: T227P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: T227P

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,931,019 V318I probably benign Het
1700018F24Rik A G 5: 145,045,346 D247G possibly damaging Het
1700123K08Rik A G 5: 138,564,141 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Accsl C A 2: 93,861,773 probably null Het
Adad2 C T 8: 119,614,761 R171C probably benign Het
Adgrv1 A C 13: 81,521,117 L2440R probably damaging Het
Antxr1 A G 6: 87,255,863 V239A probably damaging Het
Arhgap28 G A 17: 67,896,240 Q73* probably null Het
Arrdc5 C T 17: 56,297,846 R147H probably benign Het
Ash1l T C 3: 89,023,185 Y1990H probably damaging Het
Bank1 T C 3: 136,066,387 E494G probably damaging Het
Bicral A T 17: 46,808,492 I701N probably damaging Het
Bod1l T C 5: 41,821,874 Y699C probably damaging Het
Ccr3 C A 9: 124,029,481 D284E probably damaging Het
Cdh13 T C 8: 118,851,723 V163A possibly damaging Het
CK137956 C T 4: 127,946,647 probably null Het
Cltc T C 11: 86,721,646 S529G probably benign Het
Ddx11 A G 17: 66,150,026 K783E probably damaging Het
Dnah3 T A 7: 119,939,065 probably null Het
Eef2k A G 7: 120,886,782 H408R probably benign Het
Esr1 A G 10: 5,001,221 K533R probably damaging Het
Fat1 T A 8: 44,953,072 Y953* probably null Het
Fosl1 T A 19: 5,455,105 probably null Het
Frmd4b A G 6: 97,306,791 M373T probably benign Het
Gm1968 A G 16: 29,958,739 noncoding transcript Het
Gpr26 T C 7: 131,966,965 V13A possibly damaging Het
Gtf3c1 T C 7: 125,703,945 N106S possibly damaging Het
Itgb8 T G 12: 119,170,694 E546A probably damaging Het
Itpr3 C T 17: 27,118,566 T2450M probably benign Het
Kif1a A T 1: 93,025,728 Y1245N probably damaging Het
Klrb1f G A 6: 129,054,372 probably null Het
Lars A G 18: 42,257,091 L37P probably benign Het
Lnpk T C 2: 74,548,025 T131A probably benign Het
Mob3c C T 4: 115,833,681 T156I probably benign Het
Nadk T A 4: 155,584,171 W100R probably damaging Het
Npy6r A T 18: 44,275,994 I161F probably benign Het
Olfr1212 A C 2: 88,958,826 D120A probably damaging Het
Olfr773 G A 10: 129,186,557 T288I probably damaging Het
Pcdhga3 A G 18: 37,675,223 E243G possibly damaging Het
Pdss2 A G 10: 43,439,832 T361A probably benign Het
Pkd1l2 G T 8: 117,042,320 Q1198K probably benign Het
Prdx1 T A 4: 116,692,927 I102N probably damaging Het
Prss1 G A 6: 41,461,213 V25I probably benign Het
Pspc1 A G 14: 56,777,931 Y77H probably damaging Het
Rnf5 T C 17: 34,601,738 probably benign Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Ryr1 C A 7: 29,111,974 M235I probably benign Het
Sec24c A G 14: 20,691,825 Y776C probably damaging Het
Sharpin A G 15: 76,350,053 probably null Het
Slc12a4 C A 8: 105,950,213 V482L possibly damaging Het
Slc38a1 C T 15: 96,616,141 probably null Het
Smtn G T 11: 3,529,582 T495N probably damaging Het
Sncaip A G 18: 52,868,919 T171A probably benign Het
Sprr2e T C 3: 92,353,092 *77R probably null Het
Syngap1 T A 17: 26,959,780 D443E possibly damaging Het
Taldo1 T C 7: 141,392,292 V24A probably damaging Het
Tfap2c T A 2: 172,549,858 N8K probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Tubgcp3 T C 8: 12,639,577 Y563C probably damaging Het
Ubr1 T A 2: 120,892,112 D1342V probably benign Het
Usp7 C T 16: 8,716,510 probably null Het
Wbp1 C T 6: 83,120,235 G75D probably damaging Het
Zfp180 G T 7: 24,104,890 V245F probably benign Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp646 T A 7: 127,879,358 C236S probably damaging Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R8049:C3ar1 UTSW 6 122850100 missense probably damaging 0.97
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTCAGCGTTCAGTGTATTG -3'
(R):5'- CATCGAAACGTGAGAACCGC -3'

Sequencing Primer
(F):5'- GGATTTACGATCTTCAACAGGAAACC -3'
(R):5'- ACCGTGATCTGTTCATTATGGAC -3'
Posted On2016-11-08