Incidental Mutation 'R5610:Gpr26'
ID440305
Institutional Source Beutler Lab
Gene Symbol Gpr26
Ensembl Gene ENSMUSG00000040125
Gene NameG protein-coupled receptor 26
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5610 (G1)
Quality Score114
Status Not validated
Chromosome7
Chromosomal Location131966460-131994405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131966965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000041664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045840] [ENSMUST00000124096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045840
AA Change: V13A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041664
Gene: ENSMUSG00000040125
AA Change: V13A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 15 309 1.9e-7 PFAM
Pfam:7tm_1 22 294 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-couple receptor protein. G-protein-coupled receptors are a large family of membrane proteins that are involved in cellular responses to environmental stimuli, neurotransmitters, and hormones. The encoded protein may play a role in neurodegenerative diseases. Epigenetic silencing of this gene has been observed in gliomas. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit increased anxiety- and depression-related behaviors and alcohol preference. Female mice homozygous for another allele display increased susceptibility to diet-induced obesity with increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,931,019 V318I probably benign Het
1700018F24Rik A G 5: 145,045,346 D247G possibly damaging Het
1700123K08Rik A G 5: 138,564,141 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Accsl C A 2: 93,861,773 probably null Het
Adad2 C T 8: 119,614,761 R171C probably benign Het
Adgrv1 A C 13: 81,521,117 L2440R probably damaging Het
Antxr1 A G 6: 87,255,863 V239A probably damaging Het
Arhgap28 G A 17: 67,896,240 Q73* probably null Het
Arrdc5 C T 17: 56,297,846 R147H probably benign Het
Ash1l T C 3: 89,023,185 Y1990H probably damaging Het
Bank1 T C 3: 136,066,387 E494G probably damaging Het
Bicral A T 17: 46,808,492 I701N probably damaging Het
Bod1l T C 5: 41,821,874 Y699C probably damaging Het
C3ar1 T G 6: 122,850,578 T227P probably benign Het
Ccr3 C A 9: 124,029,481 D284E probably damaging Het
Cdh13 T C 8: 118,851,723 V163A possibly damaging Het
CK137956 C T 4: 127,946,647 probably null Het
Cltc T C 11: 86,721,646 S529G probably benign Het
Ddx11 A G 17: 66,150,026 K783E probably damaging Het
Dnah3 T A 7: 119,939,065 probably null Het
Eef2k A G 7: 120,886,782 H408R probably benign Het
Esr1 A G 10: 5,001,221 K533R probably damaging Het
Fat1 T A 8: 44,953,072 Y953* probably null Het
Fosl1 T A 19: 5,455,105 probably null Het
Frmd4b A G 6: 97,306,791 M373T probably benign Het
Gm1968 A G 16: 29,958,739 noncoding transcript Het
Gtf3c1 T C 7: 125,703,945 N106S possibly damaging Het
Itgb8 T G 12: 119,170,694 E546A probably damaging Het
Itpr3 C T 17: 27,118,566 T2450M probably benign Het
Kif1a A T 1: 93,025,728 Y1245N probably damaging Het
Klrb1f G A 6: 129,054,372 probably null Het
Lars A G 18: 42,257,091 L37P probably benign Het
Lnpk T C 2: 74,548,025 T131A probably benign Het
Mob3c C T 4: 115,833,681 T156I probably benign Het
Nadk T A 4: 155,584,171 W100R probably damaging Het
Npy6r A T 18: 44,275,994 I161F probably benign Het
Olfr1212 A C 2: 88,958,826 D120A probably damaging Het
Olfr773 G A 10: 129,186,557 T288I probably damaging Het
Pcdhga3 A G 18: 37,675,223 E243G possibly damaging Het
Pdss2 A G 10: 43,439,832 T361A probably benign Het
Pkd1l2 G T 8: 117,042,320 Q1198K probably benign Het
Prdx1 T A 4: 116,692,927 I102N probably damaging Het
Prss1 G A 6: 41,461,213 V25I probably benign Het
Pspc1 A G 14: 56,777,931 Y77H probably damaging Het
Rnf5 T C 17: 34,601,738 probably benign Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Ryr1 C A 7: 29,111,974 M235I probably benign Het
Sec24c A G 14: 20,691,825 Y776C probably damaging Het
Sharpin A G 15: 76,350,053 probably null Het
Slc12a4 C A 8: 105,950,213 V482L possibly damaging Het
Slc38a1 C T 15: 96,616,141 probably null Het
Smtn G T 11: 3,529,582 T495N probably damaging Het
Sncaip A G 18: 52,868,919 T171A probably benign Het
Sprr2e T C 3: 92,353,092 *77R probably null Het
Syngap1 T A 17: 26,959,780 D443E possibly damaging Het
Taldo1 T C 7: 141,392,292 V24A probably damaging Het
Tfap2c T A 2: 172,549,858 N8K probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Tubgcp3 T C 8: 12,639,577 Y563C probably damaging Het
Ubr1 T A 2: 120,892,112 D1342V probably benign Het
Usp7 C T 16: 8,716,510 probably null Het
Wbp1 C T 6: 83,120,235 G75D probably damaging Het
Zfp180 G T 7: 24,104,890 V245F probably benign Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp646 T A 7: 127,879,358 C236S probably damaging Het
Other mutations in Gpr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Gpr26 APN 7 131967501 missense probably damaging 1.00
IGL01345:Gpr26 APN 7 131967432 missense possibly damaging 0.90
IGL01658:Gpr26 APN 7 131984105 missense probably benign
IGL02724:Gpr26 APN 7 131974392 critical splice donor site probably null
R0408:Gpr26 UTSW 7 131967520 missense possibly damaging 0.81
R0408:Gpr26 UTSW 7 131974272 splice site probably null
R0547:Gpr26 UTSW 7 131984297 missense probably benign 0.01
R2508:Gpr26 UTSW 7 131967094 missense probably damaging 0.98
R4088:Gpr26 UTSW 7 131967076 missense probably benign 0.00
R4630:Gpr26 UTSW 7 131966980 missense probably damaging 1.00
R4680:Gpr26 UTSW 7 131974353 missense probably benign 0.34
R4756:Gpr26 UTSW 7 131967501 missense probably damaging 1.00
R5229:Gpr26 UTSW 7 131984247 missense probably damaging 1.00
R6605:Gpr26 UTSW 7 131984164 missense possibly damaging 0.91
R6653:Gpr26 UTSW 7 131984101 missense probably benign 0.00
R7213:Gpr26 UTSW 7 131967490 missense probably damaging 1.00
R7351:Gpr26 UTSW 7 131974365 missense probably damaging 1.00
R7768:Gpr26 UTSW 7 131974348 missense probably damaging 0.99
R7887:Gpr26 UTSW 7 131966973 missense probably benign
Z1088:Gpr26 UTSW 7 131984094 frame shift probably null
Z1176:Gpr26 UTSW 7 131967048 missense probably damaging 1.00
Z1176:Gpr26 UTSW 7 131967225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAACACTCGCCTAGGTG -3'
(R):5'- TAGCTCAGCGGAAAGACCAC -3'

Sequencing Primer
(F):5'- AACACTCGCCTAGGTGATCGC -3'
(R):5'- TGGCGGCCAGAAAGGTGTC -3'
Posted On2016-11-08