Incidental Mutation 'R5610:Slc38a1'
ID440327
Institutional Source Beutler Lab
Gene Symbol Slc38a1
Ensembl Gene ENSMUSG00000023169
Gene Namesolute carrier family 38, member 1
SynonymsNAT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R5610 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location96571418-96642913 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 96616141 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088452] [ENSMUST00000088452] [ENSMUST00000088454] [ENSMUST00000088454] [ENSMUST00000100262] [ENSMUST00000100262] [ENSMUST00000230767]
Predicted Effect probably null
Transcript: ENSMUST00000088452
SMART Domains Protein: ENSMUSP00000085799
Gene: ENSMUSG00000023169

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 6.1e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088452
SMART Domains Protein: ENSMUSP00000085799
Gene: ENSMUSG00000023169

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 6.1e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088454
SMART Domains Protein: ENSMUSP00000085801
Gene: ENSMUSG00000023169

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088454
SMART Domains Protein: ENSMUSP00000085801
Gene: ENSMUSG00000023169

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100262
SMART Domains Protein: ENSMUSP00000097833
Gene: ENSMUSG00000023169

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100262
SMART Domains Protein: ENSMUSP00000097833
Gene: ENSMUSG00000023169

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230756
Predicted Effect probably benign
Transcript: ENSMUST00000230767
AA Change: V67I

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,931,019 V318I probably benign Het
1700018F24Rik A G 5: 145,045,346 D247G possibly damaging Het
1700123K08Rik A G 5: 138,564,141 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Accsl C A 2: 93,861,773 probably null Het
Adad2 C T 8: 119,614,761 R171C probably benign Het
Adgrv1 A C 13: 81,521,117 L2440R probably damaging Het
Antxr1 A G 6: 87,255,863 V239A probably damaging Het
Arhgap28 G A 17: 67,896,240 Q73* probably null Het
Arrdc5 C T 17: 56,297,846 R147H probably benign Het
Ash1l T C 3: 89,023,185 Y1990H probably damaging Het
Bank1 T C 3: 136,066,387 E494G probably damaging Het
Bicral A T 17: 46,808,492 I701N probably damaging Het
Bod1l T C 5: 41,821,874 Y699C probably damaging Het
C3ar1 T G 6: 122,850,578 T227P probably benign Het
Ccr3 C A 9: 124,029,481 D284E probably damaging Het
Cdh13 T C 8: 118,851,723 V163A possibly damaging Het
CK137956 C T 4: 127,946,647 probably null Het
Cltc T C 11: 86,721,646 S529G probably benign Het
Ddx11 A G 17: 66,150,026 K783E probably damaging Het
Dnah3 T A 7: 119,939,065 probably null Het
Eef2k A G 7: 120,886,782 H408R probably benign Het
Esr1 A G 10: 5,001,221 K533R probably damaging Het
Fat1 T A 8: 44,953,072 Y953* probably null Het
Fosl1 T A 19: 5,455,105 probably null Het
Frmd4b A G 6: 97,306,791 M373T probably benign Het
Gm1968 A G 16: 29,958,739 noncoding transcript Het
Gpr26 T C 7: 131,966,965 V13A possibly damaging Het
Gtf3c1 T C 7: 125,703,945 N106S possibly damaging Het
Itgb8 T G 12: 119,170,694 E546A probably damaging Het
Itpr3 C T 17: 27,118,566 T2450M probably benign Het
Kif1a A T 1: 93,025,728 Y1245N probably damaging Het
Klrb1f G A 6: 129,054,372 probably null Het
Lars A G 18: 42,257,091 L37P probably benign Het
Lnpk T C 2: 74,548,025 T131A probably benign Het
Mob3c C T 4: 115,833,681 T156I probably benign Het
Nadk T A 4: 155,584,171 W100R probably damaging Het
Npy6r A T 18: 44,275,994 I161F probably benign Het
Olfr1212 A C 2: 88,958,826 D120A probably damaging Het
Olfr773 G A 10: 129,186,557 T288I probably damaging Het
Pcdhga3 A G 18: 37,675,223 E243G possibly damaging Het
Pdss2 A G 10: 43,439,832 T361A probably benign Het
Pkd1l2 G T 8: 117,042,320 Q1198K probably benign Het
Prdx1 T A 4: 116,692,927 I102N probably damaging Het
Prss1 G A 6: 41,461,213 V25I probably benign Het
Pspc1 A G 14: 56,777,931 Y77H probably damaging Het
Rnf5 T C 17: 34,601,738 probably benign Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Ryr1 C A 7: 29,111,974 M235I probably benign Het
Sec24c A G 14: 20,691,825 Y776C probably damaging Het
Sharpin A G 15: 76,350,053 probably null Het
Slc12a4 C A 8: 105,950,213 V482L possibly damaging Het
Smtn G T 11: 3,529,582 T495N probably damaging Het
Sncaip A G 18: 52,868,919 T171A probably benign Het
Sprr2e T C 3: 92,353,092 *77R probably null Het
Syngap1 T A 17: 26,959,780 D443E possibly damaging Het
Taldo1 T C 7: 141,392,292 V24A probably damaging Het
Tfap2c T A 2: 172,549,858 N8K probably benign Het
Tmem229a T C 6: 24,955,581 Y58C probably damaging Het
Tubgcp3 T C 8: 12,639,577 Y563C probably damaging Het
Ubr1 T A 2: 120,892,112 D1342V probably benign Het
Usp7 C T 16: 8,716,510 probably null Het
Wbp1 C T 6: 83,120,235 G75D probably damaging Het
Zfp180 G T 7: 24,104,890 V245F probably benign Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp646 T A 7: 127,879,358 C236S probably damaging Het
Other mutations in Slc38a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc38a1 APN 15 96585623 missense possibly damaging 0.89
IGL01376:Slc38a1 APN 15 96585556 missense probably damaging 1.00
IGL01920:Slc38a1 APN 15 96586897 missense probably benign
IGL01993:Slc38a1 APN 15 96624046 missense probably damaging 1.00
IGL02201:Slc38a1 APN 15 96578798 missense probably damaging 1.00
IGL03074:Slc38a1 APN 15 96592524 missense possibly damaging 0.72
IGL03370:Slc38a1 APN 15 96579347 missense possibly damaging 0.93
R0918:Slc38a1 UTSW 15 96609862 missense probably damaging 1.00
R1506:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R1510:Slc38a1 UTSW 15 96609860 missense probably damaging 1.00
R1713:Slc38a1 UTSW 15 96578760 missense probably damaging 1.00
R1721:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R1867:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R4254:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4255:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4754:Slc38a1 UTSW 15 96576782 missense probably damaging 0.98
R5548:Slc38a1 UTSW 15 96590474 missense probably damaging 1.00
R6235:Slc38a1 UTSW 15 96578792 missense probably benign 0.36
R6288:Slc38a1 UTSW 15 96586878 missense probably benign 0.12
R7904:Slc38a1 UTSW 15 96624040 missense possibly damaging 0.95
R8195:Slc38a1 UTSW 15 96592566 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGAACTGTGTCCAGGGAGTAG -3'
(R):5'- ACAACTTGTCAGTTTGCTGTC -3'

Sequencing Primer
(F):5'- CAGTTTAGCTGTCAGAGGCTCC -3'
(R):5'- ACAACTTGTCAGTTTGCTGTCTACAG -3'
Posted On2016-11-08