Incidental Mutation 'V7732:Gpr37'
ID44034
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene NameG protein-coupled receptor 37
Synonymsparkin-associated endothelin B-like receptor, Pael-R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #V7732 () of strain may
Quality Score173
Status Validated (trace)
Chromosome6
Chromosomal Location25665878-25690729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25669123 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 574 (Y574C)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
Predicted Effect probably benign
Transcript: ENSMUST00000054867
AA Change: Y574C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: Y574C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200812
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.9%
  • 20x: 90.3%
Validation Efficiency 96% (25/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,283,541 F793L probably benign Het
Atmin C T 8: 116,956,479 P293S probably damaging Het
Card11 G A 5: 140,876,495 R1016* probably null Het
Cep89 A G 7: 35,403,098 S79G probably damaging Het
Cic T C 7: 25,292,245 V2227A probably benign Het
Clcn6 A G 4: 148,013,955 V534A probably damaging Het
Dpep2 T A 8: 105,989,260 H124L probably damaging Het
Elfn1 G A 5: 139,971,439 R66Q probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Ggh T A 4: 20,046,225 F44L probably benign Het
Heatr5a C A 12: 51,905,324 A1178S possibly damaging Het
Igsf9 A G 1: 172,490,393 T106A probably benign Het
Itpr3 G T 17: 27,111,024 probably benign Het
Itpr3 G C 17: 27,111,026 probably null Het
Nlrp6 G A 7: 140,926,648 probably benign Het
Rabac1 T A 7: 24,972,219 Q51L probably damaging Het
Rgma A G 7: 73,417,320 T108A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sarm1 T A 11: 78,488,065 T385S probably benign Het
Spata17 T C 1: 187,048,480 T357A possibly damaging Het
Ufl1 T C 4: 25,251,368 I711V probably damaging Het
Vwa3a A G 7: 120,778,949 probably benign Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25669318 missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25669573 missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25669834 missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25688687 missense probably benign 0.05
IGL03331:Gpr37 APN 6 25669729 missense probably benign 0.26
R0375:Gpr37 UTSW 6 25669291 missense probably benign 0.08
R0534:Gpr37 UTSW 6 25669824 nonsense probably null
R0892:Gpr37 UTSW 6 25688207 missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25669138 missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R2083:Gpr37 UTSW 6 25688417 missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25669381 missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25666946 unclassified probably benign
R2848:Gpr37 UTSW 6 25666946 unclassified probably benign
R4119:Gpr37 UTSW 6 25688426 missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R4734:Gpr37 UTSW 6 25689086 missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25669108 missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25669615 missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25669352 missense probably benign 0.05
R6548:Gpr37 UTSW 6 25688813 missense probably benign 0.32
R6760:Gpr37 UTSW 6 25669169 missense probably benign 0.00
R7030:Gpr37 UTSW 6 25689005 missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25669342 missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25688787 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGATCTGAGACTGTTGGCCTCCTTC -3'
(R):5'- TGCTCAACATCATCAGCCAGTTCC -3'

Sequencing Primer
(F):5'- AGAAACATTTTTTCCCAGAGCAC -3'
(R):5'- AACATCATCAGCCAGTTCCTTTTG -3'
Posted On2013-05-31