Incidental Mutation 'R5636:Serpinb3c'
ID440345
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms1110001H02Rik, Scca2, Serpinb4, ovalbumin, 1110013A16Rik
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5636 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location107271201-107278371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107275014 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 88 (Q88R)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027565
AA Change: Q88R

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: Q88R

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107276260 critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107272783 missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107273184 missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107271972 missense probably benign
IGL02184:Serpinb3c APN 1 107271918 missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107273142 nonsense probably null
IGL03131:Serpinb3c APN 1 107271727 missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107271873 missense probably benign 0.00
R0207:Serpinb3c UTSW 1 107276992 missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107276921 missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107272787 missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107271702 missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107271774 missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107271844 missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107276931 nonsense probably null
R5464:Serpinb3c UTSW 1 107271704 missense probably damaging 0.99
R5677:Serpinb3c UTSW 1 107271803 missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107276923 missense probably benign 0.01
R6424:Serpinb3c UTSW 1 107271629 makesense probably null
R7132:Serpinb3c UTSW 1 107276951 missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107273162 missense probably null 1.00
R7319:Serpinb3c UTSW 1 107273087 missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107271714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTTGTCTATGTGAATCTGCC -3'
(R):5'- GGCATATGCTATCTTATAGGTAGAGG -3'

Sequencing Primer
(F):5'- CTATGTGAATCTGCCTGGTATTATG -3'
(R):5'- TTTGAAATAGGCAAACAGCATAACC -3'
Posted On2016-11-08