Incidental Mutation 'R5636:Serpinb3c'
ID 440345
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms 1110001H02Rik, Scca2, Serpinb4, ovalbumin, 1110013A16Rik
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 107271201-107278371 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107275014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 88 (Q88R)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
AlphaFold A2RSF9
Predicted Effect possibly damaging
Transcript: ENSMUST00000027565
AA Change: Q88R

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: Q88R

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107276260 critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107272783 missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107273184 missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107271972 missense probably benign
IGL02184:Serpinb3c APN 1 107271918 missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107273142 nonsense probably null
IGL03131:Serpinb3c APN 1 107271727 missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107271873 missense probably benign 0.00
BB001:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
BB011:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R0207:Serpinb3c UTSW 1 107276992 missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107276921 missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107272787 missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107271702 missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107271774 missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107271844 missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107276931 nonsense probably null
R5464:Serpinb3c UTSW 1 107271704 missense probably damaging 0.99
R5677:Serpinb3c UTSW 1 107271803 missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107276923 missense probably benign 0.01
R6424:Serpinb3c UTSW 1 107271629 makesense probably null
R7132:Serpinb3c UTSW 1 107276951 missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107273162 missense probably null 1.00
R7319:Serpinb3c UTSW 1 107273087 missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107271714 missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107273153 missense possibly damaging 0.95
R7922:Serpinb3c UTSW 1 107272014 missense probably damaging 1.00
R7924:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R8114:Serpinb3c UTSW 1 107276304 missense probably benign 0.03
R8189:Serpinb3c UTSW 1 107276309 missense probably benign 0.00
R8384:Serpinb3c UTSW 1 107271967 missense probably benign 0.02
R9042:Serpinb3c UTSW 1 107272001 missense probably damaging 1.00
R9518:Serpinb3c UTSW 1 107272738 missense probably damaging 0.99
R9566:Serpinb3c UTSW 1 107272695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTTGTCTATGTGAATCTGCC -3'
(R):5'- GGCATATGCTATCTTATAGGTAGAGG -3'

Sequencing Primer
(F):5'- CTATGTGAATCTGCCTGGTATTATG -3'
(R):5'- TTTGAAATAGGCAAACAGCATAACC -3'
Posted On 2016-11-08