Incidental Mutation 'R5636:Accsl'
ID 440351
Institutional Source Beutler Lab
Gene Symbol Accsl
Ensembl Gene ENSMUSG00000075023
Gene Name 1-aminocyclopropane-1-carboxylate synthase (non-functional)-like
Synonyms
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 93855361-93869157 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93869025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 7 (E7K)
Ref Sequence ENSEMBL: ENSMUSP00000097281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099690] [ENSMUST00000133562] [ENSMUST00000143033]
AlphaFold Q3UX83
Predicted Effect probably benign
Transcript: ENSMUST00000099690
AA Change: E7K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097281
Gene: ENSMUSG00000075023
AA Change: E7K

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:Aminotran_1_2 190 568 6.9e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129248
Predicted Effect probably benign
Transcript: ENSMUST00000133562
SMART Domains Protein: ENSMUSP00000120924
Gene: ENSMUSG00000075023

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141561
Predicted Effect probably benign
Transcript: ENSMUST00000143033
SMART Domains Protein: ENSMUSP00000118053
Gene: ENSMUSG00000075023

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Accsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Accsl APN 2 93865908 missense possibly damaging 0.46
IGL02511:Accsl APN 2 93861766 unclassified probably benign
IGL03248:Accsl APN 2 93862784 unclassified probably benign
IGL03338:Accsl APN 2 93855747 missense probably benign 0.34
R0323:Accsl UTSW 2 93861080 missense probably benign 0.27
R0449:Accsl UTSW 2 93866074 missense probably benign 0.00
R1172:Accsl UTSW 2 93866244 splice site probably benign
R1173:Accsl UTSW 2 93866244 splice site probably benign
R1175:Accsl UTSW 2 93866244 splice site probably benign
R1752:Accsl UTSW 2 93858030 missense probably damaging 1.00
R1952:Accsl UTSW 2 93859433 missense probably damaging 1.00
R2877:Accsl UTSW 2 93859410 missense probably damaging 0.99
R2878:Accsl UTSW 2 93859410 missense probably damaging 0.99
R4472:Accsl UTSW 2 93863991 critical splice acceptor site probably null
R4472:Accsl UTSW 2 93863992 splice site probably null
R5400:Accsl UTSW 2 93859422 missense probably damaging 0.99
R5502:Accsl UTSW 2 93856944 critical splice donor site probably null
R5610:Accsl UTSW 2 93861773 critical splice donor site probably null
R5799:Accsl UTSW 2 93864403 splice site probably null
R6376:Accsl UTSW 2 93856998 missense probably damaging 1.00
R6913:Accsl UTSW 2 93866143 missense possibly damaging 0.66
R7311:Accsl UTSW 2 93865815 missense possibly damaging 0.51
R7564:Accsl UTSW 2 93858156 missense possibly damaging 0.83
R7731:Accsl UTSW 2 93861018 missense probably benign 0.01
R7835:Accsl UTSW 2 93865984 nonsense probably null
R8184:Accsl UTSW 2 93855741 missense probably benign 0.19
R8305:Accsl UTSW 2 93866078 missense probably benign 0.00
R8824:Accsl UTSW 2 93862850 missense probably damaging 1.00
R8868:Accsl UTSW 2 93866145 missense probably benign 0.00
R8954:Accsl UTSW 2 93857954 missense probably benign 0.06
R9172:Accsl UTSW 2 93861488 missense probably damaging 1.00
R9473:Accsl UTSW 2 93855747 missense probably benign 0.03
R9513:Accsl UTSW 2 93869153 unclassified probably benign
Z1088:Accsl UTSW 2 93865948 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTACCAGACACAGAAGTAGG -3'
(R):5'- CTAGATAATGGGGAGCTGCTG -3'

Sequencing Primer
(F):5'- AAACACCGAGGTTGCTGTTGC -3'
(R):5'- CTGGGTAGTTGGCTCCAGGAG -3'
Posted On 2016-11-08