Incidental Mutation 'R5636:Traf6'
ID 440353
Institutional Source Beutler Lab
Gene Symbol Traf6
Ensembl Gene ENSMUSG00000027164
Gene Name TNF receptor-associated factor 6
Synonyms C630032O20Rik, 2310003F17Rik
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 101678429-101701669 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101696909 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 335 (V335M)
Ref Sequence ENSEMBL: ENSMUSP00000004949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004949]
AlphaFold P70196
Predicted Effect probably benign
Transcript: ENSMUST00000004949
AA Change: V335M

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004949
Gene: ENSMUSG00000027164
AA Change: V335M

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RING 70 108 8.61e-9 SMART
internal_repeat_1 132 189 3.04e-6 PROSPERO
Pfam:zf-TRAF 204 261 2.6e-22 PFAM
MATH 363 490 2.87e-14 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor associated factor (TRAF) family of adaptor proteins that mediate signaling events from members of the TNF receptor and Toll/IL-1 receptor families to activate transcription factors such as NF-kappa-B and AP-1. The product of this gene is essential for perinatal and postnatal survival. Mice deficient in this protein exhibit osteopetrosis and defective in development of epidermal appendixes, normal B cell differentiation, lymph node organogenesis, interleukin-1 signaling, lipopolysaccharide signaling and neural tube closure. This protein possesses ubiquitin ligase activity. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Viability is reduced in mice lacking both functional copies of this gene, with death occuring just before birth or around weaning. Mutants exhibit osteopetrosis and immune defects including abnormal immune cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Traf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Traf6 APN 2 101684783 missense probably benign
IGL01619:Traf6 APN 2 101690098 nonsense probably null
IGL01746:Traf6 APN 2 101696892 missense possibly damaging 0.67
IGL02071:Traf6 APN 2 101696793 missense probably benign 0.00
IGL02666:Traf6 APN 2 101697167 missense possibly damaging 0.92
IGL02693:Traf6 APN 2 101688505 missense possibly damaging 0.74
IGL02819:Traf6 APN 2 101684789 missense probably damaging 1.00
R0056:Traf6 UTSW 2 101697151 missense possibly damaging 0.81
R0390:Traf6 UTSW 2 101688588 nonsense probably null
R1470:Traf6 UTSW 2 101696649 splice site probably benign
R1727:Traf6 UTSW 2 101696739 missense probably benign
R2075:Traf6 UTSW 2 101697053 missense probably benign 0.00
R4498:Traf6 UTSW 2 101684546 missense probably benign 0.01
R5166:Traf6 UTSW 2 101690057 missense probably benign 0.03
R5385:Traf6 UTSW 2 101684755 nonsense probably null
R6005:Traf6 UTSW 2 101696684 nonsense probably null
R7472:Traf6 UTSW 2 101697192 missense probably benign 0.05
R8175:Traf6 UTSW 2 101691480 missense possibly damaging 0.86
R8462:Traf6 UTSW 2 101697456 missense probably damaging 1.00
R9004:Traf6 UTSW 2 101690098 missense probably benign 0.07
R9008:Traf6 UTSW 2 101696988 missense possibly damaging 0.89
R9224:Traf6 UTSW 2 101697167 missense probably benign 0.35
R9310:Traf6 UTSW 2 101696727 missense possibly damaging 0.47
R9489:Traf6 UTSW 2 101694280 missense probably damaging 1.00
R9510:Traf6 UTSW 2 101691480 missense possibly damaging 0.86
R9554:Traf6 UTSW 2 101688608 missense not run
Predicted Primers PCR Primer
(F):5'- GGCCCAGGCTGTTCATAATG -3'
(R):5'- CGGTAACTGAAGATGCAGGC -3'

Sequencing Primer
(F):5'- GGCCCAGGCTGTTCATAATGTTAAC -3'
(R):5'- ATGCACAGCTTGTACCCAGGTC -3'
Posted On 2016-11-08