Mutagenetix > Incidental Mutation

Incidental Mutation 'R5636:Traf6'

440353

Institutional Source

Beutler Lab

Gene Symbol

Traf6

Ensembl Gene

ENSMUSG00000027164

Gene Name

TNF receptor-associated factor 6

Synonyms

C630032O20Rik, 2310003F17Rik

MMRRC Submission

043287-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5636 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101678429-101701669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101696909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 335 (V335M)

Ref Sequence

ENSEMBL: ENSMUSP00000004949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004949]

AlphaFold

P70196

Predicted Effect

probably benign
Transcript: ENSMUST00000004949
AA Change: V335M

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000004949
Gene: ENSMUSG00000027164
AA Change: V335M

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RING	70	108	8.61e-9	SMART
internal_repeat_1	132	189	3.04e-6	PROSPERO
Pfam:zf-TRAF	204	261	2.6e-22	PFAM
MATH	363	490	2.87e-14	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the TNF receptor associated factor (TRAF) family of adaptor proteins that mediate signaling events from members of the TNF receptor and Toll/IL-1 receptor families to activate transcription factors such as NF-kappa-B and AP-1. The product of this gene is essential for perinatal and postnatal survival. Mice deficient in this protein exhibit osteopetrosis and defective in development of epidermal appendixes, normal B cell differentiation, lymph node organogenesis, interleukin-1 signaling, lipopolysaccharide signaling and neural tube closure. This protein possesses ubiquitin ligase activity. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Viability is reduced in mice lacking both functional copies of this gene, with death occuring just before birth or around weaning. Mutants exhibit osteopetrosis and immune defects including abnormal immune cell development and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	T	19: 31,944,982	Q448*	probably null	Het
Abca5	A	G	11: 110,301,536	Y717H	probably benign	Het
Abcg2	T	A	6: 58,672,056	D295E	probably damaging	Het
Accsl	C	T	2: 93,869,025	E7K	probably benign	Het
Acvr2b	A	G	9: 119,428,309	Y152C	probably damaging	Het
Akap13	A	G	7: 75,704,372	E1747G	probably damaging	Het
Arpp19	C	T	9: 75,037,933		probably benign	Het
Atp10d	A	G	5: 72,288,219	Y74C	probably damaging	Het
Atp6v0b	T	C	4: 117,886,385		probably benign	Het
Bms1	C	A	6: 118,388,825	M1133I	probably benign	Het
Bysl	A	C	17: 47,602,723	D259E	probably benign	Het
Capn1	A	T	19: 6,014,442	V9E	probably benign	Het
Cdkl2	T	C	5: 92,033,742	I127V	probably benign	Het
Cyp2c38	G	A	19: 39,438,306	Q184*	probably null	Het
Cypt12	C	T	3: 17,948,585	R41C	probably benign	Het
Fat2	T	C	11: 55,282,481	I2469V	probably damaging	Het
Fbxo38	A	G	18: 62,511,018	V923A	possibly damaging	Het
Gm13889	A	G	2: 93,956,686	C148R	probably damaging	Het
Gpd1	A	T	15: 99,722,058	T223S	probably benign	Het
Hcrtr1	C	A	4: 130,130,945	G383C	possibly damaging	Het
Hivep1	C	T	13: 42,163,456	P2047S	possibly damaging	Het
Islr2	T	C	9: 58,201,301	T35A	probably benign	Het
Lgr6	T	C	1: 134,987,078	D644G	probably benign	Het
Lrrc6	A	T	15: 66,500,816		probably null	Het
Mdn1	C	T	4: 32,695,480	T1173I	probably damaging	Het
Mon1a	T	C	9: 107,901,240	V221A	probably damaging	Het
Mrgprb4	A	G	7: 48,198,470	C237R	probably benign	Het
Myo1b	A	G	1: 51,797,528	M264T	probably damaging	Het
Naxd	A	G	8: 11,502,676	N32S	probably benign	Het
Nlrp12	A	T	7: 3,225,294	L1010Q	probably damaging	Het
Nos1ap	T	A	1: 170,349,399	K145M	probably damaging	Het
Nuggc	A	T	14: 65,648,188	K755*	probably null	Het
Olfr1501	C	T	19: 13,838,337	V279M	possibly damaging	Het
Olfr332	T	C	11: 58,490,051	K235E	probably damaging	Het
Pik3ca	G	A	3: 32,461,560	R794Q	probably damaging	Het
Pnp2	A	G	14: 50,956,192		probably null	Het
Ric3	G	A	7: 109,038,820	T242I	probably damaging	Het
Rnf213	G	A	11: 119,436,629	R1814K	probably benign	Het
Rnf213	A	C	11: 119,436,905	Q1906P	probably damaging	Het
Rufy2	T	A	10: 62,997,954	I265N	probably damaging	Het
Scap	G	T	9: 110,380,594	G744C	probably damaging	Het
Serpinb3c	T	C	1: 107,275,014	Q88R	possibly damaging	Het
Sf3b1	T	C	1: 54,997,193	D907G	probably damaging	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc4a3	C	T	1: 75,554,216	L749F	possibly damaging	Het
Smtn	T	G	11: 3,517,829		probably null	Het
Spag9	C	A	11: 94,069,012	D342E	probably damaging	Het
Sptbn5	G	A	2: 120,057,404		probably benign	Het
Stam	G	T	2: 14,117,427	M112I	probably damaging	Het
Tex35	C	T	1: 157,100,224	W125*	probably null	Het
Tmem215	A	G	4: 40,474,394	E157G	probably damaging	Het
Ubr5	T	A	15: 37,983,996	K2302N	probably damaging	Het
Vmn2r78	A	G	7: 86,954,429	H605R	probably damaging	Het

Other mutations in Traf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Traf6	APN	2	101684783	missense	probably benign
IGL01619:Traf6	APN	2	101690098	nonsense	probably null
IGL01746:Traf6	APN	2	101696892	missense	possibly damaging	0.67
IGL02071:Traf6	APN	2	101696793	missense	probably benign	0.00
IGL02666:Traf6	APN	2	101697167	missense	possibly damaging	0.92
IGL02693:Traf6	APN	2	101688505	missense	possibly damaging	0.74
IGL02819:Traf6	APN	2	101684789	missense	probably damaging	1.00
R0056:Traf6	UTSW	2	101697151	missense	possibly damaging	0.81
R0390:Traf6	UTSW	2	101688588	nonsense	probably null
R1470:Traf6	UTSW	2	101696649	splice site	probably benign
R1727:Traf6	UTSW	2	101696739	missense	probably benign
R2075:Traf6	UTSW	2	101697053	missense	probably benign	0.00
R4498:Traf6	UTSW	2	101684546	missense	probably benign	0.01
R5166:Traf6	UTSW	2	101690057	missense	probably benign	0.03
R5385:Traf6	UTSW	2	101684755	nonsense	probably null
R6005:Traf6	UTSW	2	101696684	nonsense	probably null
R7472:Traf6	UTSW	2	101697192	missense	probably benign	0.05
R8175:Traf6	UTSW	2	101691480	missense	possibly damaging	0.86
R8462:Traf6	UTSW	2	101697456	missense	probably damaging	1.00
R9004:Traf6	UTSW	2	101690098	missense	probably benign	0.07
R9008:Traf6	UTSW	2	101696988	missense	possibly damaging	0.89
R9224:Traf6	UTSW	2	101697167	missense	probably benign	0.35
R9310:Traf6	UTSW	2	101696727	missense	possibly damaging	0.47
R9489:Traf6	UTSW	2	101694280	missense	probably damaging	1.00
R9510:Traf6	UTSW	2	101691480	missense	possibly damaging	0.86
R9554:Traf6	UTSW	2	101688608	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGCCCAGGCTGTTCATAATG -3'
(R):5'- CGGTAACTGAAGATGCAGGC -3'

Sequencing Primer
(F):5'- GGCCCAGGCTGTTCATAATGTTAAC -3'
(R):5'- ATGCACAGCTTGTACCCAGGTC -3'

Posted On

2016-11-08