Incidental Mutation 'R5636:Hcrtr1'
ID 440363
Institutional Source Beutler Lab
Gene Symbol Hcrtr1
Ensembl Gene ENSMUSG00000028778
Gene Name hypocretin (orexin) receptor 1
Synonyms OX1R
MMRRC Submission 043287-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 130130217-130139359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130130945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 383 (G383C)
Ref Sequence ENSEMBL: ENSMUSP00000127290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000030563] [ENSMUST00000118199] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]
AlphaFold P58307
Predicted Effect possibly damaging
Transcript: ENSMUST00000030562
AA Change: G383C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: G383C

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030563
SMART Domains Protein: ENSMUSP00000030563
Gene: ENSMUSG00000028779

DomainStartEndE-ValueType
low complexity region 11 101 N/A INTRINSIC
EFh 109 137 2.5e-2 SMART
EFh 146 174 1.23e1 SMART
EFh 176 204 4.42e-3 SMART
Blast:EFh 243 273 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118199
SMART Domains Protein: ENSMUSP00000112638
Gene: ENSMUSG00000028779

DomainStartEndE-ValueType
low complexity region 11 101 N/A INTRINSIC
EFh 109 137 2.5e-2 SMART
EFh 146 174 1.23e1 SMART
EFh 176 204 4.42e-3 SMART
Blast:EFh 243 273 3e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000119423
AA Change: G383C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: G383C

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 5.3e-56 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120154
AA Change: G383C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: G383C

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164887
AA Change: G383C

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: G383C

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Hcrtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Hcrtr1 APN 4 130137269 missense probably damaging 1.00
IGL00754:Hcrtr1 APN 4 130137233 missense probably damaging 1.00
IGL02005:Hcrtr1 APN 4 130137263 missense probably benign 0.31
R0084:Hcrtr1 UTSW 4 130137266 missense possibly damaging 0.79
R0590:Hcrtr1 UTSW 4 130135694 missense probably damaging 0.96
R1531:Hcrtr1 UTSW 4 130130927 nonsense probably null
R1659:Hcrtr1 UTSW 4 130135336 nonsense probably null
R2055:Hcrtr1 UTSW 4 130130887 missense probably benign 0.08
R3028:Hcrtr1 UTSW 4 130135811 missense probably benign 0.31
R4488:Hcrtr1 UTSW 4 130135763 missense probably benign 0.02
R4967:Hcrtr1 UTSW 4 130130999 missense possibly damaging 0.69
R5301:Hcrtr1 UTSW 4 130137670 splice site probably null
R5375:Hcrtr1 UTSW 4 130135725 missense probably benign 0.08
R6283:Hcrtr1 UTSW 4 130135340 missense probably benign 0.01
R6505:Hcrtr1 UTSW 4 130137586 missense probably benign
R7018:Hcrtr1 UTSW 4 130135868 missense probably damaging 1.00
R7042:Hcrtr1 UTSW 4 130130860 unclassified probably benign
R7091:Hcrtr1 UTSW 4 130130914 missense probably damaging 0.99
R7259:Hcrtr1 UTSW 4 130135818 missense possibly damaging 0.79
R7612:Hcrtr1 UTSW 4 130135685 missense possibly damaging 0.61
R8140:Hcrtr1 UTSW 4 130135290 missense probably damaging 0.99
R9410:Hcrtr1 UTSW 4 130135721 missense probably damaging 0.98
R9485:Hcrtr1 UTSW 4 130137261 missense possibly damaging 0.95
Z1177:Hcrtr1 UTSW 4 130133873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCTTCCTGTGACTGCTGG -3'
(R):5'- AATTGCATTTTGCTCCAGGAACC -3'

Sequencing Primer
(F):5'- TGACTGCTGGGGTGGACC -3'
(R):5'- TTGCTCCAGGAACCGGCTG -3'
Posted On 2016-11-08