Incidental Mutation 'R5636:Abcg2'
ID 440367
Institutional Source Beutler Lab
Gene Symbol Abcg2
Ensembl Gene ENSMUSG00000029802
Gene Name ATP binding cassette subfamily G member 2 (Junior blood group)
Synonyms Bcrp
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 58584523-58695676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58672056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 295 (D295E)
Ref Sequence ENSEMBL: ENSMUSP00000138608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031822] [ENSMUST00000114294] [ENSMUST00000143752] [ENSMUST00000203146]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031822
AA Change: D295E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031822
Gene: ENSMUSG00000029802
AA Change: D295E

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 5.4e-42 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114294
AA Change: D295E

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109933
Gene: ENSMUSG00000029802
AA Change: D295E

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 1.2e-40 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143752
AA Change: D295E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138608
Gene: ENSMUSG00000029802
AA Change: D295E

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 573 7.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145685
Predicted Effect probably benign
Transcript: ENSMUST00000203146
SMART Domains Protein: ENSMUSP00000145435
Gene: ENSMUSG00000029802

DomainStartEndE-ValueType
SCOP:d1jj7a_ 33 129 7e-8 SMART
Blast:AAA 71 125 3e-32 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit extreme sensitivity to the dietary chlorophyll-catabolite pheophorbide a, resulting in severe phototoxic skin lesions upon light exposure. Mutants show a novel form of protoporphyria, associated with a 10-fold increase in erythrocyte levels of protoporphyrin IX. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Abcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01489:Abcg2 APN 6 58685823 critical splice donor site probably null
IGL01654:Abcg2 APN 6 58683321 critical splice donor site probably null
IGL02646:Abcg2 APN 6 58685696 missense probably benign 0.01
IGL03342:Abcg2 APN 6 58665135 missense probably damaging 1.00
PIT4519001:Abcg2 UTSW 6 58674807 missense probably damaging 0.99
R0092:Abcg2 UTSW 6 58685777 missense probably benign 0.14
R0313:Abcg2 UTSW 6 58672097 missense probably benign
R0742:Abcg2 UTSW 6 58678326 missense probably benign 0.00
R1165:Abcg2 UTSW 6 58678300 missense probably benign 0.21
R1302:Abcg2 UTSW 6 58685817 missense probably damaging 1.00
R1476:Abcg2 UTSW 6 58678337 missense probably benign 0.06
R1523:Abcg2 UTSW 6 58685694 missense possibly damaging 0.96
R2056:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2057:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2153:Abcg2 UTSW 6 58684322 splice site probably null
R5723:Abcg2 UTSW 6 58678351 nonsense probably null
R5972:Abcg2 UTSW 6 58672085 missense probably benign 0.00
R6319:Abcg2 UTSW 6 58674738 missense probably benign 0.03
R6896:Abcg2 UTSW 6 58683313 missense probably damaging 1.00
R7136:Abcg2 UTSW 6 58684340 missense possibly damaging 0.67
R7387:Abcg2 UTSW 6 58689624 missense possibly damaging 0.67
R8208:Abcg2 UTSW 6 58665242 missense possibly damaging 0.68
R8414:Abcg2 UTSW 6 58669236 missense probably benign 0.40
R8552:Abcg2 UTSW 6 58669225 missense possibly damaging 0.94
R8919:Abcg2 UTSW 6 58684341 missense probably benign 0.08
X0028:Abcg2 UTSW 6 58678276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAGAGTTCCTCAAGGGTC -3'
(R):5'- TCTGTCCTATGATAGAGAACCCTG -3'

Sequencing Primer
(F):5'- CTCAAGGGTCTAAAATTCCTCTGG -3'
(R):5'- CACTCAACATGAATTTTAGAGGCATG -3'
Posted On 2016-11-08