Incidental Mutation 'R5636:Ric3'
ID 440373
Institutional Source Beutler Lab
Gene Symbol Ric3
Ensembl Gene ENSMUSG00000048330
Gene Name RIC3 acetylcholine receptor chaperone
Synonyms
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109034312-109083331 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109038820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 242 (T242I)
Ref Sequence ENSEMBL: ENSMUSP00000112788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000055993] [ENSMUST00000120876] [ENSMUST00000147580]
AlphaFold Q8BPM6
Predicted Effect probably benign
Transcript: ENSMUST00000033341
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055993
AA Change: T243I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056990
Gene: ENSMUSG00000048330
AA Change: T243I

DomainStartEndE-ValueType
Pfam:RIC3 15 165 1.2e-38 PFAM
low complexity region 256 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120876
AA Change: T242I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112788
Gene: ENSMUSG00000048330
AA Change: T242I

DomainStartEndE-ValueType
Pfam:RIC3 15 165 3.9e-52 PFAM
low complexity region 255 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147580
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Ric3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ric3 APN 7 109054412 missense probably damaging 1.00
IGL00942:Ric3 APN 7 109054413 missense probably damaging 1.00
IGL02318:Ric3 APN 7 109048080 missense probably damaging 1.00
IGL02868:Ric3 APN 7 109054419 missense probably damaging 1.00
IGL03012:Ric3 APN 7 109038718 missense probably benign
R0842:Ric3 UTSW 7 109038880 missense probably damaging 1.00
R2291:Ric3 UTSW 7 109038883 missense probably damaging 1.00
R2912:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R2913:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R3690:Ric3 UTSW 7 109038610 missense possibly damaging 0.89
R4587:Ric3 UTSW 7 109054363 critical splice donor site probably null
R5039:Ric3 UTSW 7 109038723 missense probably benign
R6738:Ric3 UTSW 7 109048062 nonsense probably null
R8725:Ric3 UTSW 7 109038717 missense probably benign
R8884:Ric3 UTSW 7 109038481 missense probably benign 0.01
R8981:Ric3 UTSW 7 109057836 missense probably damaging 1.00
R9249:Ric3 UTSW 7 109048005 missense probably damaging 1.00
R9274:Ric3 UTSW 7 109048005 missense probably damaging 1.00
R9366:Ric3 UTSW 7 109054437 missense probably damaging 1.00
R9563:Ric3 UTSW 7 109038790 missense not run
R9564:Ric3 UTSW 7 109038811 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGGTTTGGGATCACACG -3'
(R):5'- GCCAGACTGCTCAGAATTTG -3'

Sequencing Primer
(F):5'- CACGGGGCAACAGAATTATCTTTC -3'
(R):5'- CCAGACTGCTCAGAATTTGTTCAAG -3'
Posted On 2016-11-08