Incidental Mutation 'R5636:Mon1a'
ID440377
Institutional Source Beutler Lab
Gene Symbol Mon1a
Ensembl Gene ENSMUSG00000032583
Gene NameMON1 homolog A, secretory traffciking associated
Synonyms2810468K17Rik
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5636 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107888151-107903139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107901240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 221 (V221A)
Ref Sequence ENSEMBL: ENSMUSP00000141516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000191906]
Predicted Effect probably damaging
Transcript: ENSMUST00000035202
AA Change: V221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583
AA Change: V221A

DomainStartEndE-ValueType
Pfam:Mon1 151 555 1.2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158380
Predicted Effect probably damaging
Transcript: ENSMUST00000191906
AA Change: V221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583
AA Change: V221A

DomainStartEndE-ValueType
Pfam:Mon1 146 461 1.1e-138 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Mon1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mon1a APN 9 107902684 missense probably damaging 1.00
IGL02104:Mon1a APN 9 107901615 missense probably damaging 1.00
IGL02223:Mon1a APN 9 107901285 missense probably damaging 1.00
IGL02268:Mon1a APN 9 107901798 missense possibly damaging 0.95
R1334:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R1708:Mon1a UTSW 9 107898718 missense probably benign 0.27
R1753:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R3774:Mon1a UTSW 9 107901303 missense probably damaging 1.00
R4964:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R4966:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R5586:Mon1a UTSW 9 107898695 missense probably damaging 0.99
R6816:Mon1a UTSW 9 107900410 missense probably damaging 1.00
R7080:Mon1a UTSW 9 107901786 missense probably damaging 1.00
R7709:Mon1a UTSW 9 107900128 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGCTAAGCACGCCAGTAAG -3'
(R):5'- TTGAAAAGCAGGTGCAGGTC -3'

Sequencing Primer
(F):5'- GTAAGCCCCTTCAGAGCTC -3'
(R):5'- CCATTAGCTGCAGCAGGTTATCG -3'
Posted On2016-11-08