Incidental Mutation 'R5636:Acvr2b'
ID440379
Institutional Source Beutler Lab
Gene Symbol Acvr2b
Ensembl Gene ENSMUSG00000061393
Gene Nameactivin receptor IIB
SynonymsActRIIB
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5636 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119402118-119434995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119428309 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 152 (Y152C)
Ref Sequence ENSEMBL: ENSMUSP00000035093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035093] [ENSMUST00000165044] [ENSMUST00000215746]
PDB Structure Crystal structure of the activin/actrIIb extracellular domain [X-RAY DIFFRACTION]
Crystal structure of a ternary ligand-receptor complex of BMP-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035093
AA Change: Y152C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035093
Gene: ENSMUSG00000061393
AA Change: Y152C

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.4e-13 PFAM
transmembrane domain 130 152 N/A INTRINSIC
Pfam:Pkinase 206 494 1.5e-55 PFAM
Pfam:Pkinase_Tyr 206 494 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165044
AA Change: Y160C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126108
Gene: ENSMUSG00000061393
AA Change: Y160C

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.3e-14 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Pkinase_Tyr 214 502 1.7e-26 PFAM
Pfam:Pkinase 217 501 1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213431
Predicted Effect probably benign
Transcript: ENSMUST00000215746
AA Change: Y160C

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217621
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene show abnormal lateral asymmetry and homeotic transformation of the axial skeleton, and die shortly after birth with extensive cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Acvr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Acvr2b APN 9 119432504 missense probably damaging 1.00
IGL02206:Acvr2b APN 9 119427998 nonsense probably null
IGL03022:Acvr2b APN 9 119427521 missense probably benign 0.10
IGL03131:Acvr2b APN 9 119431284 missense possibly damaging 0.92
R0455:Acvr2b UTSW 9 119432609 missense probably damaging 1.00
R2131:Acvr2b UTSW 9 119432808 missense probably damaging 1.00
R4744:Acvr2b UTSW 9 119431262 missense probably damaging 1.00
R5278:Acvr2b UTSW 9 119432489 missense probably damaging 0.99
R6196:Acvr2b UTSW 9 119433403 missense possibly damaging 0.71
R6253:Acvr2b UTSW 9 119428561 missense probably damaging 1.00
R6424:Acvr2b UTSW 9 119402579 missense probably benign
R6465:Acvr2b UTSW 9 119433303 missense probably damaging 1.00
R7096:Acvr2b UTSW 9 119428189 splice site probably null
R7102:Acvr2b UTSW 9 119432553 missense probably damaging 0.96
R7497:Acvr2b UTSW 9 119433286 missense probably benign
R8557:Acvr2b UTSW 9 119432588 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACTTCTGCTGCTGCGAAG -3'
(R):5'- TGATCTCCAGCAGCTGTAGTG -3'

Sequencing Primer
(F):5'- TTCACCCACTTGCCGGAG -3'
(R):5'- CAGCAGCTGTAGTGGCTTCAG -3'
Posted On2016-11-08