Mutagenetix > Incidental Mutation

Incidental Mutation 'R5636:Olfr332'

440383

Institutional Source

Beutler Lab

Gene Symbol

Olfr332

Ensembl Gene

ENSMUSG00000050813

Gene Name

olfactory receptor 332

Synonyms

GA_x6K02T2NKPP-926908-927915, MOR284-2

MMRRC Submission

043287-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R5636 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58487950-58492555 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58490051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 235 (K235E)

Ref Sequence

ENSEMBL: ENSMUSP00000136008 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180165] [ENSMUST00000203744]

AlphaFold

Q5NC45

Predicted Effect

probably damaging
Transcript: ENSMUST00000180165
AA Change: K235E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136008
Gene: ENSMUSG00000050813
AA Change: K235E

Domain	Start	End	E-Value	Type
Pfam:7tm_1	40	289	6.8e-33	PFAM
Pfam:7tm_4	138	282	4.1e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203744

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	T	19: 31,944,982	Q448*	probably null	Het
Abca5	A	G	11: 110,301,536	Y717H	probably benign	Het
Abcg2	T	A	6: 58,672,056	D295E	probably damaging	Het
Accsl	C	T	2: 93,869,025	E7K	probably benign	Het
Acvr2b	A	G	9: 119,428,309	Y152C	probably damaging	Het
Akap13	A	G	7: 75,704,372	E1747G	probably damaging	Het
Arpp19	C	T	9: 75,037,933		probably benign	Het
Atp10d	A	G	5: 72,288,219	Y74C	probably damaging	Het
Atp6v0b	T	C	4: 117,886,385		probably benign	Het
Bms1	C	A	6: 118,388,825	M1133I	probably benign	Het
Bysl	A	C	17: 47,602,723	D259E	probably benign	Het
Capn1	A	T	19: 6,014,442	V9E	probably benign	Het
Cdkl2	T	C	5: 92,033,742	I127V	probably benign	Het
Cyp2c38	G	A	19: 39,438,306	Q184*	probably null	Het
Cypt12	C	T	3: 17,948,585	R41C	probably benign	Het
Fat2	T	C	11: 55,282,481	I2469V	probably damaging	Het
Fbxo38	A	G	18: 62,511,018	V923A	possibly damaging	Het
Gm13889	A	G	2: 93,956,686	C148R	probably damaging	Het
Gpd1	A	T	15: 99,722,058	T223S	probably benign	Het
Hcrtr1	C	A	4: 130,130,945	G383C	possibly damaging	Het
Hivep1	C	T	13: 42,163,456	P2047S	possibly damaging	Het
Islr2	T	C	9: 58,201,301	T35A	probably benign	Het
Lgr6	T	C	1: 134,987,078	D644G	probably benign	Het
Lrrc6	A	T	15: 66,500,816		probably null	Het
Mdn1	C	T	4: 32,695,480	T1173I	probably damaging	Het
Mon1a	T	C	9: 107,901,240	V221A	probably damaging	Het
Mrgprb4	A	G	7: 48,198,470	C237R	probably benign	Het
Myo1b	A	G	1: 51,797,528	M264T	probably damaging	Het
Naxd	A	G	8: 11,502,676	N32S	probably benign	Het
Nlrp12	A	T	7: 3,225,294	L1010Q	probably damaging	Het
Nos1ap	T	A	1: 170,349,399	K145M	probably damaging	Het
Nuggc	A	T	14: 65,648,188	K755*	probably null	Het
Olfr1501	C	T	19: 13,838,337	V279M	possibly damaging	Het
Pik3ca	G	A	3: 32,461,560	R794Q	probably damaging	Het
Pnp2	A	G	14: 50,956,192		probably null	Het
Ric3	G	A	7: 109,038,820	T242I	probably damaging	Het
Rnf213	G	A	11: 119,436,629	R1814K	probably benign	Het
Rnf213	A	C	11: 119,436,905	Q1906P	probably damaging	Het
Rufy2	T	A	10: 62,997,954	I265N	probably damaging	Het
Scap	G	T	9: 110,380,594	G744C	probably damaging	Het
Serpinb3c	T	C	1: 107,275,014	Q88R	possibly damaging	Het
Sf3b1	T	C	1: 54,997,193	D907G	probably damaging	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc4a3	C	T	1: 75,554,216	L749F	possibly damaging	Het
Smtn	T	G	11: 3,517,829		probably null	Het
Spag9	C	A	11: 94,069,012	D342E	probably damaging	Het
Sptbn5	G	A	2: 120,057,404		probably benign	Het
Stam	G	T	2: 14,117,427	M112I	probably damaging	Het
Tex35	C	T	1: 157,100,224	W125*	probably null	Het
Tmem215	A	G	4: 40,474,394	E157G	probably damaging	Het
Traf6	G	A	2: 101,696,909	V335M	probably benign	Het
Ubr5	T	A	15: 37,983,996	K2302N	probably damaging	Het
Vmn2r78	A	G	7: 86,954,429	H605R	probably damaging	Het

Other mutations in Olfr332

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02510:Olfr332	APN	11	58490539	missense	probably damaging	1.00
R1671:Olfr332	UTSW	11	58490609	missense	possibly damaging	0.63
R2193:Olfr332	UTSW	11	58489906	missense	probably damaging	0.97
R2393:Olfr332	UTSW	11	58490720	missense	probably benign	0.20
R4713:Olfr332	UTSW	11	58490087	missense	probably benign	0.01
R5328:Olfr332	UTSW	11	58490429	missense	possibly damaging	0.91
R6092:Olfr332	UTSW	11	58490074	missense	probably damaging	1.00
R7011:Olfr332	UTSW	11	58490144	missense	possibly damaging	0.69
R7172:Olfr332	UTSW	11	58489745	missense	unknown
R7427:Olfr332	UTSW	11	58489780	missense	probably benign
R8832:Olfr332	UTSW	11	58490237	missense	possibly damaging	0.94
R9159:Olfr332	UTSW	11	58490524	missense	probably damaging	1.00
R9289:Olfr332	UTSW	11	58489919	missense	probably benign	0.22
Z1186:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1186:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1186:Olfr332	UTSW	11	58490488	missense	probably benign
Z1187:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1187:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1187:Olfr332	UTSW	11	58490488	missense	probably benign
Z1188:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1188:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1188:Olfr332	UTSW	11	58490488	missense	probably benign
Z1189:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1189:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1189:Olfr332	UTSW	11	58490488	missense	probably benign
Z1190:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1190:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1190:Olfr332	UTSW	11	58490488	missense	probably benign
Z1191:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1191:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1191:Olfr332	UTSW	11	58490488	missense	probably benign
Z1192:Olfr332	UTSW	11	58489748	nonsense	probably null
Z1192:Olfr332	UTSW	11	58490297	missense	probably benign	0.01
Z1192:Olfr332	UTSW	11	58490488	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTATCACGGCTGCAGCATC -3'
(R):5'- TGAGATGCCCGCTATTCTGAG -3'

Sequencing Primer
(F):5'- TCCTTGTTTCTCAGGCTGTAGATAAG -3'
(R):5'- AGATGCCCGCTATTCTGAGAATGTC -3'

Posted On

2016-11-08