Incidental Mutation 'R5636:Capn1'
ID 440397
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Name calpain 1
Synonyms mu-calpin, Capa1, Capa-1
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 5988546-6015825 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6014442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 9 (V9E)
Ref Sequence ENSEMBL: ENSMUSP00000127498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
AlphaFold O35350
Predicted Effect probably benign
Transcript: ENSMUST00000025891
AA Change: V9E

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: V9E

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164843
AA Change: V9E

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: V9E

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180505
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3830:Capn1 UTSW 19 5994847 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4694:Capn1 UTSW 19 5994731 nonsense probably null
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7091:Capn1 UTSW 19 5991556 missense possibly damaging 0.64
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
R7779:Capn1 UTSW 19 5994086 missense probably benign
R8514:Capn1 UTSW 19 5997824 missense probably damaging 0.98
R8708:Capn1 UTSW 19 6011298 missense probably damaging 1.00
R9452:Capn1 UTSW 19 6007257 missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGGACCCAGTTCCTTGAAG -3'
(R):5'- ACACCCCTTTCCAGATTCTGAG -3'

Sequencing Primer
(F):5'- AGTTCCTTGAAGCCCAGGC -3'
(R):5'- TTCCAGATTCTGAGAGCCTAAC -3'
Posted On 2016-11-08