Incidental Mutation 'R5636:Olfr1501'
ID 440398
Institutional Source Beutler Lab
Gene Symbol Olfr1501
Ensembl Gene ENSMUSG00000057270
Gene Name olfactory receptor 1501
Synonyms GA_x6K02T2RE5P-4171358-4170411, MOR212-3
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 13835033-13850692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 13838337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 279 (V279M)
Ref Sequence ENSEMBL: ENSMUSP00000151094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073966] [ENSMUST00000208493] [ENSMUST00000215350]
AlphaFold Q8VFQ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000073966
AA Change: V279M

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073620
Gene: ENSMUSG00000057270
AA Change: V279M

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.8e-45 PFAM
Pfam:7tm_1 40 306 7.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208493
AA Change: V279M

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215350
AA Change: V279M

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,944,982 Q448* probably null Het
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in Olfr1501
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Olfr1501 APN 19 13838952 missense probably damaging 0.98
IGL01724:Olfr1501 APN 19 13838861 missense probably damaging 1.00
IGL02075:Olfr1501 APN 19 13838466 missense probably damaging 0.99
IGL02179:Olfr1501 APN 19 13838487 missense probably benign 0.01
IGL02410:Olfr1501 APN 19 13839131 missense probably benign
IGL02927:Olfr1501 APN 19 13838924 missense probably benign 0.05
R0234:Olfr1501 UTSW 19 13838538 missense possibly damaging 0.62
R0234:Olfr1501 UTSW 19 13838538 missense possibly damaging 0.62
R2149:Olfr1501 UTSW 19 13838582 missense probably damaging 1.00
R3442:Olfr1501 UTSW 19 13839006 missense possibly damaging 0.92
R3922:Olfr1501 UTSW 19 13838766 missense probably damaging 1.00
R3924:Olfr1501 UTSW 19 13838766 missense probably damaging 1.00
R4856:Olfr1501 UTSW 19 13838279 missense probably damaging 0.99
R4886:Olfr1501 UTSW 19 13838279 missense probably damaging 0.99
R5175:Olfr1501 UTSW 19 13838316 missense probably damaging 1.00
R5716:Olfr1501 UTSW 19 13838639 missense probably damaging 1.00
R6080:Olfr1501 UTSW 19 13839100 missense possibly damaging 0.76
R6849:Olfr1501 UTSW 19 13838839 nonsense probably null
R7011:Olfr1501 UTSW 19 13839039 missense probably benign 0.04
R8223:Olfr1501 UTSW 19 13838861 missense probably damaging 1.00
R8508:Olfr1501 UTSW 19 13838402 missense possibly damaging 0.80
R9176:Olfr1501 UTSW 19 13838432 missense probably damaging 1.00
X0026:Olfr1501 UTSW 19 13838657 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTGCAATTCTGAGAGCAAAGTC -3'
(R):5'- TTACGCGAACAGGTCATCTTCC -3'

Sequencing Primer
(F):5'- GCCCAACAGATAGGAACT -3'
(R):5'- CACAACTAGTGTTTCAGTGATTCTTG -3'
Posted On 2016-11-08