Incidental Mutation 'R5636:A1cf'
ID 440399
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene Name APOBEC1 complementation factor
Synonyms 1810073H04Rik, apobec-1 complementation factor, ACF
MMRRC Submission 043287-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 31846164-31926395 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 31922382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 448 (Q448*)
Ref Sequence ENSEMBL: ENSMUSP00000153542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304]
AlphaFold Q5YD48
Predicted Effect probably null
Transcript: ENSMUST00000075838
AA Change: Q456*
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: Q456*

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224304
AA Change: Q448*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,192,362 (GRCm39) Y717H probably benign Het
Abcg2 T A 6: 58,649,041 (GRCm39) D295E probably damaging Het
Accsl C T 2: 93,699,370 (GRCm39) E7K probably benign Het
Acvr2b A G 9: 119,257,375 (GRCm39) Y152C probably damaging Het
Akap13 A G 7: 75,354,120 (GRCm39) E1747G probably damaging Het
Arpp19 C T 9: 74,945,215 (GRCm39) probably benign Het
Atp10d A G 5: 72,445,562 (GRCm39) Y74C probably damaging Het
Atp6v0b T C 4: 117,743,582 (GRCm39) probably benign Het
Bms1 C A 6: 118,365,786 (GRCm39) M1133I probably benign Het
Bysl A C 17: 47,913,648 (GRCm39) D259E probably benign Het
Capn1 A T 19: 6,064,472 (GRCm39) V9E probably benign Het
Cdkl2 T C 5: 92,181,601 (GRCm39) I127V probably benign Het
Cyp2c38 G A 19: 39,426,750 (GRCm39) Q184* probably null Het
Cypt12 C T 3: 18,002,749 (GRCm39) R41C probably benign Het
Dnaaf11 A T 15: 66,372,665 (GRCm39) probably null Het
Fat2 T C 11: 55,173,307 (GRCm39) I2469V probably damaging Het
Fbxo38 A G 18: 62,644,089 (GRCm39) V923A possibly damaging Het
Gm13889 A G 2: 93,787,031 (GRCm39) C148R probably damaging Het
Gpd1 A T 15: 99,619,939 (GRCm39) T223S probably benign Het
Hcrtr1 C A 4: 130,024,738 (GRCm39) G383C possibly damaging Het
Hivep1 C T 13: 42,316,932 (GRCm39) P2047S possibly damaging Het
Islr2 T C 9: 58,108,584 (GRCm39) T35A probably benign Het
Lgr6 T C 1: 134,914,816 (GRCm39) D644G probably benign Het
Mdn1 C T 4: 32,695,480 (GRCm39) T1173I probably damaging Het
Mon1a T C 9: 107,778,439 (GRCm39) V221A probably damaging Het
Mrgprb4 A G 7: 47,848,218 (GRCm39) C237R probably benign Het
Myo1b A G 1: 51,836,687 (GRCm39) M264T probably damaging Het
Naxd A G 8: 11,552,676 (GRCm39) N32S probably benign Het
Nlrp12 A T 7: 3,273,926 (GRCm39) L1010Q probably damaging Het
Nos1ap T A 1: 170,176,968 (GRCm39) K145M probably damaging Het
Nuggc A T 14: 65,885,637 (GRCm39) K755* probably null Het
Or2av9 T C 11: 58,380,877 (GRCm39) K235E probably damaging Het
Or9i2 C T 19: 13,815,701 (GRCm39) V279M possibly damaging Het
Pik3ca G A 3: 32,515,709 (GRCm39) R794Q probably damaging Het
Pnp2 A G 14: 51,193,649 (GRCm39) probably null Het
Ric3 G A 7: 108,638,027 (GRCm39) T242I probably damaging Het
Rnf213 A C 11: 119,327,731 (GRCm39) Q1906P probably damaging Het
Rnf213 G A 11: 119,327,455 (GRCm39) R1814K probably benign Het
Rufy2 T A 10: 62,833,733 (GRCm39) I265N probably damaging Het
Scap G T 9: 110,209,662 (GRCm39) G744C probably damaging Het
Serpinb3c T C 1: 107,202,744 (GRCm39) Q88R possibly damaging Het
Sf3b1 T C 1: 55,036,352 (GRCm39) D907G probably damaging Het
Skint8 C A 4: 111,807,390 (GRCm39) L359M probably damaging Het
Slc4a3 C T 1: 75,530,860 (GRCm39) L749F possibly damaging Het
Smtn T G 11: 3,467,829 (GRCm39) probably null Het
Spag9 C A 11: 93,959,838 (GRCm39) D342E probably damaging Het
Sptbn5 G A 2: 119,887,885 (GRCm39) probably benign Het
Stam G T 2: 14,122,238 (GRCm39) M112I probably damaging Het
Tex35 C T 1: 156,927,794 (GRCm39) W125* probably null Het
Tmem215 A G 4: 40,474,394 (GRCm39) E157G probably damaging Het
Traf6 G A 2: 101,527,254 (GRCm39) V335M probably benign Het
Ubr5 T A 15: 37,984,240 (GRCm39) K2302N probably damaging Het
Vmn2r78 A G 7: 86,603,637 (GRCm39) H605R probably damaging Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31,898,351 (GRCm39) missense possibly damaging 0.90
IGL01411:A1cf APN 19 31,888,629 (GRCm39) missense possibly damaging 0.94
IGL01445:A1cf APN 19 31,923,198 (GRCm39) missense probably benign 0.32
IGL02165:A1cf APN 19 31,904,586 (GRCm39) missense possibly damaging 0.92
IGL02543:A1cf APN 19 31,895,495 (GRCm39) missense probably damaging 0.97
IGL02651:A1cf APN 19 31,909,906 (GRCm39) missense probably benign 0.25
IGL02904:A1cf APN 19 31,912,206 (GRCm39) missense probably damaging 1.00
Haywire UTSW 19 31,895,524 (GRCm39) critical splice donor site probably null
R0281:A1cf UTSW 19 31,923,214 (GRCm39) missense probably benign 0.09
R0349:A1cf UTSW 19 31,910,062 (GRCm39) missense possibly damaging 0.62
R0662:A1cf UTSW 19 31,898,338 (GRCm39) missense probably benign 0.00
R0697:A1cf UTSW 19 31,888,567 (GRCm39) missense probably damaging 1.00
R1055:A1cf UTSW 19 31,909,919 (GRCm39) missense probably benign 0.05
R1125:A1cf UTSW 19 31,898,378 (GRCm39) missense probably benign 0.00
R1448:A1cf UTSW 19 31,886,196 (GRCm39) missense possibly damaging 0.88
R1554:A1cf UTSW 19 31,886,302 (GRCm39) missense possibly damaging 0.66
R1616:A1cf UTSW 19 31,912,175 (GRCm39) missense probably damaging 0.98
R1660:A1cf UTSW 19 31,870,507 (GRCm39) nonsense probably null
R1719:A1cf UTSW 19 31,904,526 (GRCm39) missense probably damaging 1.00
R2338:A1cf UTSW 19 31,909,945 (GRCm39) missense probably benign
R2435:A1cf UTSW 19 31,898,294 (GRCm39) missense probably benign 0.02
R2890:A1cf UTSW 19 31,895,417 (GRCm39) missense probably benign 0.05
R3688:A1cf UTSW 19 31,888,569 (GRCm39) missense probably damaging 1.00
R4007:A1cf UTSW 19 31,895,524 (GRCm39) critical splice donor site probably null
R4208:A1cf UTSW 19 31,910,060 (GRCm39) missense probably benign 0.00
R4448:A1cf UTSW 19 31,923,262 (GRCm39) missense probably benign
R5072:A1cf UTSW 19 31,895,385 (GRCm39) missense probably benign 0.18
R5491:A1cf UTSW 19 31,895,462 (GRCm39) missense possibly damaging 0.57
R5932:A1cf UTSW 19 31,870,518 (GRCm39) missense possibly damaging 0.68
R7066:A1cf UTSW 19 31,904,514 (GRCm39) missense probably damaging 0.99
R7211:A1cf UTSW 19 31,904,541 (GRCm39) missense probably benign 0.23
R7413:A1cf UTSW 19 31,895,524 (GRCm39) critical splice donor site probably null
R7545:A1cf UTSW 19 31,912,190 (GRCm39) missense possibly damaging 0.80
R8020:A1cf UTSW 19 31,870,594 (GRCm39) missense probably benign 0.01
R8344:A1cf UTSW 19 31,888,519 (GRCm39) missense possibly damaging 0.77
R8497:A1cf UTSW 19 31,923,250 (GRCm39) missense probably benign
R8989:A1cf UTSW 19 31,904,556 (GRCm39) missense possibly damaging 0.56
R9327:A1cf UTSW 19 31,895,499 (GRCm39) missense probably benign 0.12
R9436:A1cf UTSW 19 31,909,975 (GRCm39) missense probably benign
Z1176:A1cf UTSW 19 31,895,417 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGAGTCCAGGTTAAGTTCAAC -3'
(R):5'- ATTTAATTACAAGGGAGTGGGCTG -3'

Sequencing Primer
(F):5'- TCTGAAGTTCAGAGCTCG -3'
(R):5'- GTTATTGGAGTGATGATCAAACACAG -3'
Posted On 2016-11-08