Incidental Mutation 'R5636:A1cf'
ID 440399
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene Name APOBEC1 complementation factor
Synonyms apobec-1 complementation factor, ACF, 1810073H04Rik
MMRRC Submission 043287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5636 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 31868764-31948573 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 31944982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 448 (Q448*)
Ref Sequence ENSEMBL: ENSMUSP00000153542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304]
AlphaFold Q5YD48
Predicted Effect probably null
Transcript: ENSMUST00000075838
AA Change: Q456*
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: Q456*

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224304
AA Change: Q448*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,301,536 Y717H probably benign Het
Abcg2 T A 6: 58,672,056 D295E probably damaging Het
Accsl C T 2: 93,869,025 E7K probably benign Het
Acvr2b A G 9: 119,428,309 Y152C probably damaging Het
Akap13 A G 7: 75,704,372 E1747G probably damaging Het
Arpp19 C T 9: 75,037,933 probably benign Het
Atp10d A G 5: 72,288,219 Y74C probably damaging Het
Atp6v0b T C 4: 117,886,385 probably benign Het
Bms1 C A 6: 118,388,825 M1133I probably benign Het
Bysl A C 17: 47,602,723 D259E probably benign Het
Capn1 A T 19: 6,014,442 V9E probably benign Het
Cdkl2 T C 5: 92,033,742 I127V probably benign Het
Cyp2c38 G A 19: 39,438,306 Q184* probably null Het
Cypt12 C T 3: 17,948,585 R41C probably benign Het
Fat2 T C 11: 55,282,481 I2469V probably damaging Het
Fbxo38 A G 18: 62,511,018 V923A possibly damaging Het
Gm13889 A G 2: 93,956,686 C148R probably damaging Het
Gpd1 A T 15: 99,722,058 T223S probably benign Het
Hcrtr1 C A 4: 130,130,945 G383C possibly damaging Het
Hivep1 C T 13: 42,163,456 P2047S possibly damaging Het
Islr2 T C 9: 58,201,301 T35A probably benign Het
Lgr6 T C 1: 134,987,078 D644G probably benign Het
Lrrc6 A T 15: 66,500,816 probably null Het
Mdn1 C T 4: 32,695,480 T1173I probably damaging Het
Mon1a T C 9: 107,901,240 V221A probably damaging Het
Mrgprb4 A G 7: 48,198,470 C237R probably benign Het
Myo1b A G 1: 51,797,528 M264T probably damaging Het
Naxd A G 8: 11,502,676 N32S probably benign Het
Nlrp12 A T 7: 3,225,294 L1010Q probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nuggc A T 14: 65,648,188 K755* probably null Het
Olfr1501 C T 19: 13,838,337 V279M possibly damaging Het
Olfr332 T C 11: 58,490,051 K235E probably damaging Het
Pik3ca G A 3: 32,461,560 R794Q probably damaging Het
Pnp2 A G 14: 50,956,192 probably null Het
Ric3 G A 7: 109,038,820 T242I probably damaging Het
Rnf213 G A 11: 119,436,629 R1814K probably benign Het
Rnf213 A C 11: 119,436,905 Q1906P probably damaging Het
Rufy2 T A 10: 62,997,954 I265N probably damaging Het
Scap G T 9: 110,380,594 G744C probably damaging Het
Serpinb3c T C 1: 107,275,014 Q88R possibly damaging Het
Sf3b1 T C 1: 54,997,193 D907G probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc4a3 C T 1: 75,554,216 L749F possibly damaging Het
Smtn T G 11: 3,517,829 probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sptbn5 G A 2: 120,057,404 probably benign Het
Stam G T 2: 14,117,427 M112I probably damaging Het
Tex35 C T 1: 157,100,224 W125* probably null Het
Tmem215 A G 4: 40,474,394 E157G probably damaging Het
Traf6 G A 2: 101,696,909 V335M probably benign Het
Ubr5 T A 15: 37,983,996 K2302N probably damaging Het
Vmn2r78 A G 7: 86,954,429 H605R probably damaging Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31920951 missense possibly damaging 0.90
IGL01411:A1cf APN 19 31911229 missense possibly damaging 0.94
IGL01445:A1cf APN 19 31945798 missense probably benign 0.32
IGL02165:A1cf APN 19 31927186 missense possibly damaging 0.92
IGL02543:A1cf APN 19 31918095 missense probably damaging 0.97
IGL02651:A1cf APN 19 31932506 missense probably benign 0.25
IGL02904:A1cf APN 19 31934806 missense probably damaging 1.00
Haywire UTSW 19 31918124 critical splice donor site probably null
R0281:A1cf UTSW 19 31945814 missense probably benign 0.09
R0349:A1cf UTSW 19 31932662 missense possibly damaging 0.62
R0662:A1cf UTSW 19 31920938 missense probably benign 0.00
R0697:A1cf UTSW 19 31911167 missense probably damaging 1.00
R1055:A1cf UTSW 19 31932519 missense probably benign 0.05
R1125:A1cf UTSW 19 31920978 missense probably benign 0.00
R1448:A1cf UTSW 19 31908796 missense possibly damaging 0.88
R1554:A1cf UTSW 19 31908902 missense possibly damaging 0.66
R1616:A1cf UTSW 19 31934775 missense probably damaging 0.98
R1660:A1cf UTSW 19 31893107 nonsense probably null
R1719:A1cf UTSW 19 31927126 missense probably damaging 1.00
R2338:A1cf UTSW 19 31932545 missense probably benign
R2435:A1cf UTSW 19 31920894 missense probably benign 0.02
R2890:A1cf UTSW 19 31918017 missense probably benign 0.05
R3688:A1cf UTSW 19 31911169 missense probably damaging 1.00
R4007:A1cf UTSW 19 31918124 critical splice donor site probably null
R4208:A1cf UTSW 19 31932660 missense probably benign 0.00
R4448:A1cf UTSW 19 31945862 missense probably benign
R5072:A1cf UTSW 19 31917985 missense probably benign 0.18
R5491:A1cf UTSW 19 31918062 missense possibly damaging 0.57
R5932:A1cf UTSW 19 31893118 missense possibly damaging 0.68
R7066:A1cf UTSW 19 31927114 missense probably damaging 0.99
R7211:A1cf UTSW 19 31927141 missense probably benign 0.23
R7413:A1cf UTSW 19 31918124 critical splice donor site probably null
R7545:A1cf UTSW 19 31934790 missense possibly damaging 0.80
R8020:A1cf UTSW 19 31893194 missense probably benign 0.01
R8344:A1cf UTSW 19 31911119 missense possibly damaging 0.77
R8497:A1cf UTSW 19 31945850 missense probably benign
R8989:A1cf UTSW 19 31927156 missense possibly damaging 0.56
R9327:A1cf UTSW 19 31918099 missense probably benign 0.12
R9436:A1cf UTSW 19 31932575 missense probably benign
Z1176:A1cf UTSW 19 31918017 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGAGTCCAGGTTAAGTTCAAC -3'
(R):5'- ATTTAATTACAAGGGAGTGGGCTG -3'

Sequencing Primer
(F):5'- TCTGAAGTTCAGAGCTCG -3'
(R):5'- GTTATTGGAGTGATGATCAAACACAG -3'
Posted On 2016-11-08