Incidental Mutation 'R5637:Dnah7c'
ID 440402
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R5637 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 46760361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000189749
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAATTGCATCCACTATGTGG -3'
(R):5'- ACTTGACGTTAATGCCATTGAC -3'

Sequencing Primer
(F):5'- GTTGACATTAATTTCCCCCACAGAG -3'
(R):5'- GACGTTAATGCCATTGACTAGTTTC -3'
Posted On 2016-11-08