Incidental Mutation 'R5637:Trib3'
ID440415
Institutional Source Beutler Lab
Gene Symbol Trib3
Ensembl Gene ENSMUSG00000032715
Gene Nametribbles pseudokinase 3
SynonymsNipk, Ifld2, Trb3, SKIP3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152337422-152344032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152338490 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 261 (F261S)
Ref Sequence ENSEMBL: ENSMUSP00000041747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040312]
Predicted Effect probably damaging
Transcript: ENSMUST00000040312
AA Change: F261S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041747
Gene: ENSMUSG00000032715
AA Change: F261S

DomainStartEndE-ValueType
low complexity region 39 65 N/A INTRINSIC
Pfam:Pkinase 78 315 3.2e-27 PFAM
Pfam:Pkinase_Tyr 102 307 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124995
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mutants may display hypoactivity, decreased blood pressure and abnormal digit morphology or abnormal mast cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Trib3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Trib3 APN 2 152343150 missense probably benign 0.02
R2570:Trib3 UTSW 2 152343236 missense probably benign 0.01
R5759:Trib3 UTSW 2 152343295 missense probably benign 0.28
R6221:Trib3 UTSW 2 152338608 missense probably damaging 1.00
R6698:Trib3 UTSW 2 152338419 missense probably damaging 1.00
R7443:Trib3 UTSW 2 152339772 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTCAACCAGGGATGCAAG -3'
(R):5'- CTATTCCAGAGGACCTGAGTGG -3'

Sequencing Primer
(F):5'- AAGAGGATTCCCAGGGCCAC -3'
(R):5'- TTCTGTCTGTGACCCAGGACG -3'
Posted On2016-11-08