Incidental Mutation 'R5637:Sh3bp2'
ID440425
Institutional Source Beutler Lab
Gene Symbol Sh3bp2
Ensembl Gene ENSMUSG00000054520
Gene NameSH3-domain binding protein 2
Synonyms3BP2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34525838-34563641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34561048 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 531 (R531S)
Ref Sequence ENSEMBL: ENSMUSP00000112554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067638] [ENSMUST00000101316] [ENSMUST00000118545] [ENSMUST00000179943]
Predicted Effect probably benign
Transcript: ENSMUST00000067638
AA Change: R475S

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000070890
Gene: ENSMUSG00000054520
AA Change: R475S

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101316
AA Change: R519S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098874
Gene: ENSMUSG00000054520
AA Change: R519S

DomainStartEndE-ValueType
PH 71 176 1.33e-18 SMART
low complexity region 185 195 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
low complexity region 414 429 N/A INTRINSIC
SH2 497 586 2.04e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118545
AA Change: R531S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112554
Gene: ENSMUSG00000054520
AA Change: R531S

DomainStartEndE-ValueType
PH 83 188 1.33e-18 SMART
low complexity region 197 207 N/A INTRINSIC
low complexity region 226 241 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
SH2 509 598 2.04e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153750
Predicted Effect probably benign
Transcript: ENSMUST00000179943
AA Change: R475S

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136671
Gene: ENSMUSG00000054520
AA Change: R475S

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Nullizygous mutations may lead to higher pre-B cell numbers and impaired B cell receptor signaling or thymus-independent type 2 humoral responses. Homozygosity for a knock-in allele causes premature death, enhanced osteoclast differentiation and TNF production, systemic bone loss and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Sh3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Sh3bp2 APN 5 34556003 missense probably damaging 0.99
IGL02478:Sh3bp2 APN 5 34551662 missense probably damaging 1.00
IGL03196:Sh3bp2 APN 5 34557343 missense probably damaging 1.00
IGL03329:Sh3bp2 APN 5 34559202 missense probably benign 0.00
R0718:Sh3bp2 UTSW 5 34555495 missense probably damaging 0.99
R1322:Sh3bp2 UTSW 5 34555493 missense probably damaging 1.00
R1501:Sh3bp2 UTSW 5 34555576 critical splice donor site probably null
R1573:Sh3bp2 UTSW 5 34560690 missense probably benign 0.01
R1649:Sh3bp2 UTSW 5 34559004 missense possibly damaging 0.61
R1939:Sh3bp2 UTSW 5 34551619 missense probably damaging 1.00
R2021:Sh3bp2 UTSW 5 34544225 critical splice acceptor site probably benign
R2372:Sh3bp2 UTSW 5 34559496 missense probably benign 0.00
R2903:Sh3bp2 UTSW 5 34543556 nonsense probably null
R3709:Sh3bp2 UTSW 5 34551658 missense probably damaging 1.00
R4344:Sh3bp2 UTSW 5 34555542 missense possibly damaging 0.86
R4391:Sh3bp2 UTSW 5 34549718 missense probably benign
R5068:Sh3bp2 UTSW 5 34556967 missense probably benign 0.00
R5658:Sh3bp2 UTSW 5 34556947 missense probably damaging 1.00
R6005:Sh3bp2 UTSW 5 34562465 missense possibly damaging 0.65
R6014:Sh3bp2 UTSW 5 34559627 missense probably benign 0.00
R6391:Sh3bp2 UTSW 5 34561603 missense probably damaging 1.00
R6737:Sh3bp2 UTSW 5 34562474 missense probably damaging 1.00
R7144:Sh3bp2 UTSW 5 34561631 missense probably benign 0.00
R7536:Sh3bp2 UTSW 5 34543557 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCAGTGGGTCTGAATCGG -3'
(R):5'- AGGCAGCCATATTTTCTCCC -3'

Sequencing Primer
(F):5'- GCCTCTATTACAACCGAAA -3'
(R):5'- CTCCCAACTTACAGAAATCTTTGAG -3'
Posted On2016-11-08