Incidental Mutation 'R5637:Mfap3l'
ID440444
Institutional Source Beutler Lab
Gene Symbol Mfap3l
Ensembl Gene ENSMUSG00000031647
Gene Namemicrofibrillar-associated protein 3-like
Synonyms5430405D20Rik, NYD-sp9, 4933428A15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60632827-60676729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60656787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 66 (I66F)
Ref Sequence ENSEMBL: ENSMUSP00000124330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034066] [ENSMUST00000160719] [ENSMUST00000161421] [ENSMUST00000161702]
Predicted Effect probably damaging
Transcript: ENSMUST00000034066
AA Change: I66F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034066
Gene: ENSMUSG00000031647
AA Change: I66F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 59 132 5.65e-12 SMART
transmembrane domain 150 172 N/A INTRINSIC
low complexity region 343 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160719
AA Change: I66F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125139
Gene: ENSMUSG00000031647
AA Change: I66F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 59 132 5.65e-12 SMART
transmembrane domain 150 172 N/A INTRINSIC
low complexity region 343 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161421
SMART Domains Protein: ENSMUSP00000124136
Gene: ENSMUSG00000031647

DomainStartEndE-ValueType
SCOP:d1biha4 1 39 1e-9 SMART
Blast:IG 1 40 1e-18 BLAST
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 240 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161702
AA Change: I66F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124330
Gene: ENSMUSG00000031647
AA Change: I66F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 59 132 5.65e-12 SMART
transmembrane domain 150 172 N/A INTRINSIC
low complexity region 343 374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Mfap3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Mfap3l APN 8 60671909 missense probably benign 0.28
IGL00958:Mfap3l APN 8 60671482 missense probably benign 0.00
IGL01995:Mfap3l APN 8 60671464 missense possibly damaging 0.59
R0761:Mfap3l UTSW 8 60671581 missense possibly damaging 0.88
R1888:Mfap3l UTSW 8 60671390 missense possibly damaging 0.94
R1888:Mfap3l UTSW 8 60671390 missense possibly damaging 0.94
R4646:Mfap3l UTSW 8 60671150 missense probably damaging 1.00
R5286:Mfap3l UTSW 8 60656869 missense probably benign 0.19
R6216:Mfap3l UTSW 8 60671807 missense probably damaging 0.97
R7124:Mfap3l UTSW 8 60671269 missense probably damaging 0.97
R7597:Mfap3l UTSW 8 60671281 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATCTCTGGCCTTACGGAACAAG -3'
(R):5'- ACCACTCACGTTAAGGGTATG -3'

Sequencing Primer
(F):5'- TCAGAAGAGCCATCTGACTGTGTG -3'
(R):5'- CACTCACGTTAAGGGTATGGGCTC -3'
Posted On2016-11-08