Incidental Mutation 'R5637:Lta4h'
ID440453
Institutional Source Beutler Lab
Gene Symbol Lta4h
Ensembl Gene ENSMUSG00000015889
Gene Nameleukotriene A4 hydrolase
SynonymsLTA4 hydrodase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93453411-93484875 bp(+) (GRCm38)
Type of Mutationsplice site (41 bp from exon)
DNA Base Change (assembly) A to G at 93468869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016033]
Predicted Effect probably null
Transcript: ENSMUST00000016033
SMART Domains Protein: ENSMUSP00000016033
Gene: ENSMUSG00000015889

DomainStartEndE-ValueType
Pfam:Peptidase_M1 13 387 7.8e-80 PFAM
Leuk-A4-hydro_C 464 608 2.01e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216174
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have grossly normal phenotypes. Inflammatory reactions are reduced as are some other immunological responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcdha9 T C 18: 36,998,373 V165A probably benign Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Lta4h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Lta4h APN 10 93471370 splice site probably benign
IGL02309:Lta4h APN 10 93474490 missense probably damaging 1.00
IGL02351:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02358:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02589:Lta4h APN 10 93474931 missense probably benign 0.01
IGL02649:Lta4h APN 10 93472969 missense probably benign 0.00
IGL03164:Lta4h APN 10 93470797 splice site probably benign
R0498:Lta4h UTSW 10 93471971 splice site probably benign
R1451:Lta4h UTSW 10 93480728 missense probably damaging 0.99
R1690:Lta4h UTSW 10 93484692 missense probably benign
R1837:Lta4h UTSW 10 93469175 missense probably damaging 1.00
R4202:Lta4h UTSW 10 93470807 missense probably damaging 1.00
R4684:Lta4h UTSW 10 93468816 missense probably benign
R5528:Lta4h UTSW 10 93471874 missense probably damaging 1.00
R5873:Lta4h UTSW 10 93469190 critical splice donor site probably null
R6965:Lta4h UTSW 10 93471897 nonsense probably null
R7282:Lta4h UTSW 10 93453511 start codon destroyed probably null 0.98
R7779:Lta4h UTSW 10 93474949 missense probably benign 0.06
R8045:Lta4h UTSW 10 93469106 missense probably damaging 1.00
R8281:Lta4h UTSW 10 93453594 missense probably damaging 1.00
R8306:Lta4h UTSW 10 93482264 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGACCCAGATGAGTAATTTGACTG -3'
(R):5'- TGAGACAAGGGTTCTCCATGC -3'

Sequencing Primer
(F):5'- GACTGGAATTTCTCTCATGAAGC -3'
(R):5'- CTGCAATTTTAAGCATGGATTCGGTC -3'
Posted On2016-11-08