Incidental Mutation 'R5637:Pcdha9'
ID440466
Institutional Source Beutler Lab
Gene Symbol Pcdha9
Ensembl Gene ENSMUSG00000103770
Gene Nameprotocadherin alpha 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5637 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36997880-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36998373 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 165 (V165A)
Ref Sequence ENSEMBL: ENSMUSP00000111323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
AA Change: V165A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,152,852 N1267D probably benign Het
Acmsd T C 1: 127,766,313 F327L probably damaging Het
Adgrl3 C A 5: 81,693,544 S824Y probably damaging Het
AF366264 A T 8: 13,837,713 M126K possibly damaging Het
Arfip2 A G 7: 105,637,163 M144T probably damaging Het
Arhgap32 A G 9: 32,247,206 N179S probably damaging Het
Ash2l T C 8: 25,827,311 Y249C probably damaging Het
Ccndbp1 A G 2: 121,011,684 T141A probably benign Het
Cd177 T A 7: 24,756,323 H258L probably benign Het
Celsr3 T C 9: 108,837,133 W1956R probably damaging Het
Cep295 T C 9: 15,333,812 probably null Het
Cngb1 T C 8: 95,257,921 H420R probably damaging Het
Cobl C T 11: 12,296,531 probably benign Het
Cobll1 T C 2: 65,125,903 D337G possibly damaging Het
Dmrta1 A G 4: 89,688,831 N175D probably benign Het
Dnah7b G T 1: 46,356,514 V3859L possibly damaging Het
Dnah7c A G 1: 46,760,361 probably null Het
Dusp4 C A 8: 34,817,297 H255Q probably damaging Het
Evx1 T C 6: 52,315,766 V134A possibly damaging Het
F12 T C 13: 55,422,415 K93E possibly damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Frem2 A G 3: 53,652,937 I1383T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr158 A G 2: 21,783,272 I575V probably benign Het
Hdc A G 2: 126,616,189 V71A probably benign Het
Helb G A 10: 120,105,448 T445M probably benign Het
Inppl1 A T 7: 101,828,848 S652R probably benign Het
Itpripl1 T C 2: 127,142,124 D26G probably damaging Het
Klc1 T A 12: 111,774,408 L106H probably damaging Het
Klhl25 T A 7: 75,865,792 probably null Het
Krt6a T C 15: 101,692,279 D318G probably benign Het
Lrp2 T C 2: 69,472,418 N2989S probably damaging Het
Lta4h A G 10: 93,468,869 probably null Het
Man1c1 A G 4: 134,591,424 S251P probably damaging Het
Mapre2 T C 18: 23,753,862 probably benign Het
Mfap3l A T 8: 60,656,787 I66F probably damaging Het
Mvk A G 5: 114,455,942 E286G possibly damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1275 T A 2: 111,231,111 K227N probably benign Het
Olfr307 G A 7: 86,335,604 T264I probably benign Het
Olfr867 A T 9: 20,054,983 V160D possibly damaging Het
Pcdh9 A G 14: 93,885,762 F991L possibly damaging Het
Pcsk6 A G 7: 65,968,997 H437R probably damaging Het
Pfas C T 11: 68,993,323 V589M probably damaging Het
Prpf40a A G 2: 53,156,734 V288A possibly damaging Het
Rnf183 T C 4: 62,428,150 D137G probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Scap G A 9: 110,381,572 A991T possibly damaging Het
Sdk2 C A 11: 113,833,179 V1222F probably damaging Het
Sdr16c6 T A 4: 4,063,232 N181I possibly damaging Het
Serpinb7 A T 1: 107,428,307 D20V probably damaging Het
Sh3bp2 C A 5: 34,561,048 R531S possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox2 A G 3: 34,650,528 N38S probably benign Het
Spg7 C A 8: 123,094,575 Q680K possibly damaging Het
Styk1 T C 6: 131,300,418 E331G possibly damaging Het
Tkfc G A 19: 10,594,533 R380W probably benign Het
Trib3 A G 2: 152,338,490 F261S probably damaging Het
Ubr1 T A 2: 120,963,517 Q62L possibly damaging Het
Vmn2r54 T C 7: 12,615,369 Y762C probably benign Het
Vmn2r97 T A 17: 18,947,366 Y627* probably null Het
Zfp12 A G 5: 143,245,696 K625E probably damaging Het
Zw10 T C 9: 49,057,650 V38A probably damaging Het
Other mutations in Pcdha9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0761:Pcdha9 UTSW 18 36999963 nonsense probably null
R2985:Pcdha9 UTSW 18 36998202 missense possibly damaging 0.88
R3926:Pcdha9 UTSW 18 36999412 missense probably damaging 1.00
R4049:Pcdha9 UTSW 18 36997942 missense probably benign 0.16
R4409:Pcdha9 UTSW 18 36999145 missense probably benign 0.12
R4816:Pcdha9 UTSW 18 36999458 missense probably damaging 1.00
R4905:Pcdha9 UTSW 18 36998892 missense probably damaging 0.96
R4991:Pcdha9 UTSW 18 36998345 missense probably damaging 0.99
R5484:Pcdha9 UTSW 18 36998103 missense probably damaging 1.00
R5487:Pcdha9 UTSW 18 36999650 missense probably damaging 1.00
R5617:Pcdha9 UTSW 18 36998816 missense probably benign 0.03
R5694:Pcdha9 UTSW 18 36998372 missense probably benign 0.00
R5975:Pcdha9 UTSW 18 36999111 missense probably benign 0.00
R6089:Pcdha9 UTSW 18 36998498 missense probably benign 0.00
R6176:Pcdha9 UTSW 18 36998931 missense probably benign 0.24
R6220:Pcdha9 UTSW 18 36998478 missense probably damaging 1.00
R6238:Pcdha9 UTSW 18 36998975 missense probably benign 0.43
R6391:Pcdha9 UTSW 18 36997919 missense probably benign 0.12
R6622:Pcdha9 UTSW 18 36998654 missense possibly damaging 0.84
R6720:Pcdha9 UTSW 18 36998069 missense probably damaging 0.99
R7239:Pcdha9 UTSW 18 36998498 missense probably benign 0.06
R7624:Pcdha9 UTSW 18 36999796 nonsense probably null
R7721:Pcdha9 UTSW 18 36999636 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGGTAAATCTTCAGAATGGC -3'
(R):5'- TGTCAGTAGCAACTTTAGCTGAG -3'

Sequencing Primer
(F):5'- GGTAAATCTTCAGAATGGCATTTTG -3'
(R):5'- GAACAAGCACTGGAAATTTGCCTTTG -3'
Posted On2016-11-08