Incidental Mutation 'R5638:Nos1ap'
ID440470
Institutional Source Beutler Lab
Gene Symbol Nos1ap
Ensembl Gene ENSMUSG00000038473
Gene Namenitric oxide synthase 1 (neuronal) adaptor protein
Synonyms6330408P19Rik
MMRRC Submission 043168-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5638 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170302668-170589861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 170349399 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 145 (K145M)
Ref Sequence ENSEMBL: ENSMUSP00000124240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160456] [ENSMUST00000160466] [ENSMUST00000161485] [ENSMUST00000161966]
Predicted Effect probably damaging
Transcript: ENSMUST00000160456
AA Change: K145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125251
Gene: ENSMUSG00000038473
AA Change: K145M

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 313 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160466
AA Change: K91M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125687
Gene: ENSMUSG00000038473
AA Change: K91M

DomainStartEndE-ValueType
Pfam:PID 1 116 4e-25 PFAM
low complexity region 212 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160816
Predicted Effect probably damaging
Transcript: ENSMUST00000161485
AA Change: K96M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124169
Gene: ENSMUSG00000038473
AA Change: K96M

DomainStartEndE-ValueType
Pfam:PID 1 121 3e-26 PFAM
low complexity region 213 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161966
AA Change: K145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124240
Gene: ENSMUSG00000038473
AA Change: K145M

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 285 N/A INTRINSIC
low complexity region 290 322 N/A INTRINSIC
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,452,895 A96T probably benign Het
A930018M24Rik T C 14: 50,896,957 D76G possibly damaging Het
Adamtsl3 A T 7: 82,611,750 R1631W probably damaging Het
Alg5 C T 3: 54,738,833 H40Y probably benign Het
B3galt1 T C 2: 68,118,751 L270P probably damaging Het
Ceacam3 A G 7: 17,159,935 Y457C probably damaging Het
Cenpa A T 5: 30,673,392 R124W probably damaging Het
Cfap44 A G 16: 44,455,531 T1385A possibly damaging Het
Chd9 A T 8: 91,011,450 H1570L possibly damaging Het
Cmtm4 T C 8: 104,357,724 I113V probably benign Het
Dmxl1 T C 18: 49,891,626 I1789T possibly damaging Het
Dpf3 G A 12: 83,324,940 R174W probably damaging Het
Dusp26 T C 8: 31,094,141 L92P probably damaging Het
Fndc7 T A 3: 108,862,892 T659S possibly damaging Het
Fry A G 5: 150,359,081 H357R possibly damaging Het
G0s2 A T 1: 193,272,551 L75H probably damaging Het
Gm10184 T C 17: 89,910,207 E37G probably damaging Het
Gm5493 A G 17: 22,750,092 T82A probably benign Het
Herc2 T C 7: 56,204,416 V3690A probably benign Het
Igf2bp3 C A 6: 49,087,800 V537F probably damaging Het
Kntc1 C T 5: 123,818,475 R2101W possibly damaging Het
Mrgpra6 G T 7: 47,185,909 P255T probably damaging Het
Ncor2 A G 5: 125,048,300 V229A probably benign Het
Olfr800 T A 10: 129,660,100 I98K possibly damaging Het
Olfr836 T A 9: 19,121,380 C142S probably benign Het
Ppt2 C A 17: 34,625,849 M140I probably benign Het
Ppwd1 A G 13: 104,220,398 I203T probably damaging Het
Prpf6 A G 2: 181,645,588 T589A probably benign Het
Psd4 T C 2: 24,397,415 L453P probably benign Het
Ptpn14 A G 1: 189,786,841 T23A probably damaging Het
Rxrb T C 17: 34,037,407 L374P probably damaging Het
Scaf4 T C 16: 90,244,310 E710G unknown Het
Sik1 C T 17: 31,850,828 V216I probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc30a5 T A 13: 100,813,872 K236* probably null Het
Slc38a4 A C 15: 97,012,990 S135A probably damaging Het
Slc9a1 T A 4: 133,412,260 V263D probably damaging Het
Socs2 T C 10: 95,392,883 I168M unknown Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sspo T C 6: 48,492,891 S4508P possibly damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Stip1 G A 19: 7,032,515 P213L probably damaging Het
Tarbp1 A T 8: 126,450,686 L749Q probably damaging Het
Thsd7b T G 1: 129,595,533 S24R probably benign Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vmn2r65 C T 7: 84,940,839 C623Y probably damaging Het
Vps54 T C 11: 21,308,799 V742A probably damaging Het
Other mutations in Nos1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Nos1ap APN 1 170514606 splice site probably benign
IGL01151:Nos1ap APN 1 170589276 missense probably damaging 1.00
IGL02056:Nos1ap APN 1 170318623 missense possibly damaging 0.93
IGL02712:Nos1ap APN 1 170329251 missense possibly damaging 0.93
IGL03177:Nos1ap APN 1 170390730 critical splice donor site probably null
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0621:Nos1ap UTSW 1 170318581 missense probably damaging 0.99
R1332:Nos1ap UTSW 1 170349432 missense probably damaging 1.00
R1523:Nos1ap UTSW 1 170338118 missense probably benign 0.03
R1660:Nos1ap UTSW 1 170514637 missense possibly damaging 0.89
R1704:Nos1ap UTSW 1 170338212 missense probably damaging 1.00
R1764:Nos1ap UTSW 1 170318878 missense possibly damaging 0.83
R1905:Nos1ap UTSW 1 170318558 missense possibly damaging 0.70
R2056:Nos1ap UTSW 1 170327646 missense probably damaging 1.00
R2140:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R2141:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R3890:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3891:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3892:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R4109:Nos1ap UTSW 1 170318668 missense probably benign
R5305:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5306:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5412:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5414:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5444:Nos1ap UTSW 1 170375251 missense probably damaging 1.00
R5636:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5637:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5753:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5754:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5787:Nos1ap UTSW 1 170318572 missense probably benign 0.41
R7060:Nos1ap UTSW 1 170338125 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGCACACAGTTCAGATGACTC -3'
(R):5'- ATTAGTGAGCTCTGTCTTCTGC -3'

Sequencing Primer
(F):5'- GCACACAGTTCAGATGACTCTAAAG -3'
(R):5'- CCTCCCGTGAGCAGAGGTTTC -3'
Posted On2016-11-08