Incidental Mutation 'R5638:Ceacam3'
ID440487
Institutional Source Beutler Lab
Gene Symbol Ceacam3
Ensembl Gene ENSMUSG00000053228
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 3
SynonymsEG384557, cea12, Psg24
MMRRC Submission 043168-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5638 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17150282-17164253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17159935 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 457 (Y457C)
Ref Sequence ENSEMBL: ENSMUSP00000104131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065540
AA Change: Y457C

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069892
Gene: ENSMUSG00000053228
AA Change: Y457C

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
IG 35 136 2.83e-3 SMART
IG 155 256 6.31e-1 SMART
IG 275 376 1.42e-3 SMART
IG 395 494 2.08e-1 SMART
IG 511 610 1.26e0 SMART
IGc2 628 692 7.64e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108491
AA Change: Y457C

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104131
Gene: ENSMUSG00000053228
AA Change: Y457C

DomainStartEndE-ValueType
IG 40 141 2.83e-3 SMART
IG 160 261 6.31e-1 SMART
IG 280 379 8.01e-3 SMART
IG 398 497 2.08e-1 SMART
IG 514 613 1.26e0 SMART
IGc2 631 695 7.64e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,452,895 A96T probably benign Het
A930018M24Rik T C 14: 50,896,957 D76G possibly damaging Het
Adamtsl3 A T 7: 82,611,750 R1631W probably damaging Het
Alg5 C T 3: 54,738,833 H40Y probably benign Het
B3galt1 T C 2: 68,118,751 L270P probably damaging Het
Cenpa A T 5: 30,673,392 R124W probably damaging Het
Cfap44 A G 16: 44,455,531 T1385A possibly damaging Het
Chd9 A T 8: 91,011,450 H1570L possibly damaging Het
Cmtm4 T C 8: 104,357,724 I113V probably benign Het
Dmxl1 T C 18: 49,891,626 I1789T possibly damaging Het
Dpf3 G A 12: 83,324,940 R174W probably damaging Het
Dusp26 T C 8: 31,094,141 L92P probably damaging Het
Fndc7 T A 3: 108,862,892 T659S possibly damaging Het
Fry A G 5: 150,359,081 H357R possibly damaging Het
G0s2 A T 1: 193,272,551 L75H probably damaging Het
Gm10184 T C 17: 89,910,207 E37G probably damaging Het
Gm5493 A G 17: 22,750,092 T82A probably benign Het
Herc2 T C 7: 56,204,416 V3690A probably benign Het
Igf2bp3 C A 6: 49,087,800 V537F probably damaging Het
Kntc1 C T 5: 123,818,475 R2101W possibly damaging Het
Mrgpra6 G T 7: 47,185,909 P255T probably damaging Het
Ncor2 A G 5: 125,048,300 V229A probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr800 T A 10: 129,660,100 I98K possibly damaging Het
Olfr836 T A 9: 19,121,380 C142S probably benign Het
Ppt2 C A 17: 34,625,849 M140I probably benign Het
Ppwd1 A G 13: 104,220,398 I203T probably damaging Het
Prpf6 A G 2: 181,645,588 T589A probably benign Het
Psd4 T C 2: 24,397,415 L453P probably benign Het
Ptpn14 A G 1: 189,786,841 T23A probably damaging Het
Rxrb T C 17: 34,037,407 L374P probably damaging Het
Scaf4 T C 16: 90,244,310 E710G unknown Het
Sik1 C T 17: 31,850,828 V216I probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc30a5 T A 13: 100,813,872 K236* probably null Het
Slc38a4 A C 15: 97,012,990 S135A probably damaging Het
Slc9a1 T A 4: 133,412,260 V263D probably damaging Het
Socs2 T C 10: 95,392,883 I168M unknown Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sspo T C 6: 48,492,891 S4508P possibly damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Stip1 G A 19: 7,032,515 P213L probably damaging Het
Tarbp1 A T 8: 126,450,686 L749Q probably damaging Het
Thsd7b T G 1: 129,595,533 S24R probably benign Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vmn2r65 C T 7: 84,940,839 C623Y probably damaging Het
Vps54 T C 11: 21,308,799 V742A probably damaging Het
Other mutations in Ceacam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ceacam3 APN 7 17151857 missense probably benign 0.03
IGL01510:Ceacam3 APN 7 17159842 missense probably benign 0.00
IGL01830:Ceacam3 APN 7 17155000 missense possibly damaging 0.79
IGL02155:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02281:Ceacam3 APN 7 17161731 missense probably benign 0.43
IGL02301:Ceacam3 APN 7 17163101 missense probably damaging 1.00
IGL02320:Ceacam3 APN 7 17161940 missense probably benign 0.43
IGL02514:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02929:Ceacam3 APN 7 17158190 missense probably damaging 1.00
IGL03143:Ceacam3 APN 7 17158120 nonsense probably null
IGL03269:Ceacam3 APN 7 17161842 missense probably damaging 0.99
R0408:Ceacam3 UTSW 7 17151883 critical splice donor site probably benign
R0591:Ceacam3 UTSW 7 17151883 critical splice donor site probably null
R1274:Ceacam3 UTSW 7 17163139 missense probably damaging 0.98
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1490:Ceacam3 UTSW 7 17163146 missense probably damaging 1.00
R1635:Ceacam3 UTSW 7 17159977 missense probably damaging 1.00
R1769:Ceacam3 UTSW 7 17158376 missense probably damaging 1.00
R2345:Ceacam3 UTSW 7 17155000 missense possibly damaging 0.79
R2367:Ceacam3 UTSW 7 17151888 splice site probably null
R2403:Ceacam3 UTSW 7 17161854 missense probably damaging 1.00
R4030:Ceacam3 UTSW 7 17158342 missense probably benign 0.43
R4240:Ceacam3 UTSW 7 17160024 missense possibly damaging 0.95
R5305:Ceacam3 UTSW 7 17151576 missense probably damaging 1.00
R5314:Ceacam3 UTSW 7 17158371 missense possibly damaging 0.94
R5433:Ceacam3 UTSW 7 17159883 missense possibly damaging 0.48
R5538:Ceacam3 UTSW 7 17158421 missense probably damaging 1.00
R5787:Ceacam3 UTSW 7 17155046 missense possibly damaging 0.80
R5891:Ceacam3 UTSW 7 17151793 missense probably damaging 1.00
R5918:Ceacam3 UTSW 7 17159745 missense probably damaging 0.99
R6074:Ceacam3 UTSW 7 17151559 missense probably benign 0.05
R6386:Ceacam3 UTSW 7 17158219 missense probably benign 0.22
R6439:Ceacam3 UTSW 7 17158328 missense possibly damaging 0.59
R6455:Ceacam3 UTSW 7 17161938 missense possibly damaging 0.81
R7150:Ceacam3 UTSW 7 17151562 missense
R7196:Ceacam3 UTSW 7 17154956 missense
R7201:Ceacam3 UTSW 7 17158238 nonsense probably null
R7731:Ceacam3 UTSW 7 17158350 missense
R7833:Ceacam3 UTSW 7 17159853 missense
R7916:Ceacam3 UTSW 7 17159853 missense
Predicted Primers PCR Primer
(F):5'- TCGATCCAGTTCCACAGCAG -3'
(R):5'- CCAAATGCCAATGTGAGGACAC -3'

Sequencing Primer
(F):5'- CAGGCTGCTAAAGGAGAAAATGTTC -3'
(R):5'- CCAGTCCACATAGTACAGTTATAAAG -3'
Posted On2016-11-08