Incidental Mutation 'R5638:Tarbp1'
ID440497
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission 043168-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5638 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126450686 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 749 (L749Q)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect probably damaging
Transcript: ENSMUST00000170518
AA Change: L749Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: L749Q

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,452,895 A96T probably benign Het
A930018M24Rik T C 14: 50,896,957 D76G possibly damaging Het
Adamtsl3 A T 7: 82,611,750 R1631W probably damaging Het
Alg5 C T 3: 54,738,833 H40Y probably benign Het
B3galt1 T C 2: 68,118,751 L270P probably damaging Het
Ceacam3 A G 7: 17,159,935 Y457C probably damaging Het
Cenpa A T 5: 30,673,392 R124W probably damaging Het
Cfap44 A G 16: 44,455,531 T1385A possibly damaging Het
Chd9 A T 8: 91,011,450 H1570L possibly damaging Het
Cmtm4 T C 8: 104,357,724 I113V probably benign Het
Dmxl1 T C 18: 49,891,626 I1789T possibly damaging Het
Dpf3 G A 12: 83,324,940 R174W probably damaging Het
Dusp26 T C 8: 31,094,141 L92P probably damaging Het
Fndc7 T A 3: 108,862,892 T659S possibly damaging Het
Fry A G 5: 150,359,081 H357R possibly damaging Het
G0s2 A T 1: 193,272,551 L75H probably damaging Het
Gm10184 T C 17: 89,910,207 E37G probably damaging Het
Gm5493 A G 17: 22,750,092 T82A probably benign Het
Herc2 T C 7: 56,204,416 V3690A probably benign Het
Igf2bp3 C A 6: 49,087,800 V537F probably damaging Het
Kntc1 C T 5: 123,818,475 R2101W possibly damaging Het
Mrgpra6 G T 7: 47,185,909 P255T probably damaging Het
Ncor2 A G 5: 125,048,300 V229A probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr800 T A 10: 129,660,100 I98K possibly damaging Het
Olfr836 T A 9: 19,121,380 C142S probably benign Het
Ppt2 C A 17: 34,625,849 M140I probably benign Het
Ppwd1 A G 13: 104,220,398 I203T probably damaging Het
Prpf6 A G 2: 181,645,588 T589A probably benign Het
Psd4 T C 2: 24,397,415 L453P probably benign Het
Ptpn14 A G 1: 189,786,841 T23A probably damaging Het
Rxrb T C 17: 34,037,407 L374P probably damaging Het
Scaf4 T C 16: 90,244,310 E710G unknown Het
Sik1 C T 17: 31,850,828 V216I probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc30a5 T A 13: 100,813,872 K236* probably null Het
Slc38a4 A C 15: 97,012,990 S135A probably damaging Het
Slc9a1 T A 4: 133,412,260 V263D probably damaging Het
Socs2 T C 10: 95,392,883 I168M unknown Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sspo T C 6: 48,492,891 S4508P possibly damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Stip1 G A 19: 7,032,515 P213L probably damaging Het
Thsd7b T G 1: 129,595,533 S24R probably benign Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vmn2r65 C T 7: 84,940,839 C623Y probably damaging Het
Vps54 T C 11: 21,308,799 V742A probably damaging Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7882:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
R7982:Tarbp1 UTSW 8 126444301 missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 126427128 missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 126444195 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTCAAAGCTCGGATGTGTCC -3'
(R):5'- CTGCCTGAATTCTGCTTGTGAG -3'

Sequencing Primer
(F):5'- CGGATGTGTCCCAGCTATAC -3'
(R):5'- GCCTGAATTCTGCTTGTGAGAAATC -3'
Posted On2016-11-08