Incidental Mutation 'R5638:Ppwd1'
ID440506
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Namepeptidylprolyl isomerase domain and WD repeat containing 1
Synonyms4632422M10Rik, A330090G21Rik
MMRRC Submission 043168-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5638 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104205124-104228843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104220398 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 203 (I203T)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
Predicted Effect probably damaging
Transcript: ENSMUST00000022226
AA Change: I203T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: I203T

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225798
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,452,895 A96T probably benign Het
A930018M24Rik T C 14: 50,896,957 D76G possibly damaging Het
Adamtsl3 A T 7: 82,611,750 R1631W probably damaging Het
Alg5 C T 3: 54,738,833 H40Y probably benign Het
B3galt1 T C 2: 68,118,751 L270P probably damaging Het
Ceacam3 A G 7: 17,159,935 Y457C probably damaging Het
Cenpa A T 5: 30,673,392 R124W probably damaging Het
Cfap44 A G 16: 44,455,531 T1385A possibly damaging Het
Chd9 A T 8: 91,011,450 H1570L possibly damaging Het
Cmtm4 T C 8: 104,357,724 I113V probably benign Het
Dmxl1 T C 18: 49,891,626 I1789T possibly damaging Het
Dpf3 G A 12: 83,324,940 R174W probably damaging Het
Dusp26 T C 8: 31,094,141 L92P probably damaging Het
Fndc7 T A 3: 108,862,892 T659S possibly damaging Het
Fry A G 5: 150,359,081 H357R possibly damaging Het
G0s2 A T 1: 193,272,551 L75H probably damaging Het
Gm10184 T C 17: 89,910,207 E37G probably damaging Het
Gm5493 A G 17: 22,750,092 T82A probably benign Het
Herc2 T C 7: 56,204,416 V3690A probably benign Het
Igf2bp3 C A 6: 49,087,800 V537F probably damaging Het
Kntc1 C T 5: 123,818,475 R2101W possibly damaging Het
Mrgpra6 G T 7: 47,185,909 P255T probably damaging Het
Ncor2 A G 5: 125,048,300 V229A probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr800 T A 10: 129,660,100 I98K possibly damaging Het
Olfr836 T A 9: 19,121,380 C142S probably benign Het
Ppt2 C A 17: 34,625,849 M140I probably benign Het
Prpf6 A G 2: 181,645,588 T589A probably benign Het
Psd4 T C 2: 24,397,415 L453P probably benign Het
Ptpn14 A G 1: 189,786,841 T23A probably damaging Het
Rxrb T C 17: 34,037,407 L374P probably damaging Het
Scaf4 T C 16: 90,244,310 E710G unknown Het
Sik1 C T 17: 31,850,828 V216I probably damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc30a5 T A 13: 100,813,872 K236* probably null Het
Slc38a4 A C 15: 97,012,990 S135A probably damaging Het
Slc9a1 T A 4: 133,412,260 V263D probably damaging Het
Socs2 T C 10: 95,392,883 I168M unknown Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sspo T C 6: 48,492,891 S4508P possibly damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Stip1 G A 19: 7,032,515 P213L probably damaging Het
Tarbp1 A T 8: 126,450,686 L749Q probably damaging Het
Thsd7b T G 1: 129,595,533 S24R probably benign Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vmn2r65 C T 7: 84,940,839 C623Y probably damaging Het
Vps54 T C 11: 21,308,799 V742A probably damaging Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCTGTGTCTGTCTTATACTCCCAG -3'
(R):5'- TGCTAAAGGTAGGCCAGAGC -3'

Sequencing Primer
(F):5'- CCCAGTTCACATTTTTAGGGAAC -3'
(R):5'- CTAAAGGTAGGCCAGAGCATTTTG -3'
Posted On2016-11-08