Incidental Mutation 'R5639:Ankrd26'
ID440537
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
MMRRC Submission 043288-MU
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5639 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118539724 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 493 (E493G)
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112830
AA Change: E493G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827
AA Change: E493G

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188022
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,043,234 Y322H probably benign Het
Aldh1a1 C A 19: 20,623,422 T201K probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Bicc1 A T 10: 70,940,520 V701E probably damaging Het
Car11 T A 7: 45,702,621 probably null Het
Celsr1 C G 15: 86,030,767 V1002L probably damaging Het
Clpx T A 9: 65,329,830 S597T probably benign Het
Cyr61 A C 3: 145,648,697 V153G probably damaging Het
Dmpk A G 7: 19,092,600 M545V probably benign Het
Dnah7c C G 1: 46,739,668 D3139E probably benign Het
Drd5 T A 5: 38,319,835 V57D possibly damaging Het
Epc2 A G 2: 49,451,891 N29S possibly damaging Het
Ercc3 T C 18: 32,265,714 V682A probably damaging Het
Fam186a T C 15: 99,947,050 K438E unknown Het
Farp1 T A 14: 121,275,382 I764N probably damaging Het
Flvcr2 A T 12: 85,747,476 I209F probably benign Het
Fndc3b C T 3: 27,426,153 V1065M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gp6 C A 7: 4,394,131 D102Y probably damaging Het
Gpc5 T C 14: 115,092,747 L114P probably benign Het
Kcnq3 T A 15: 65,997,750 E613V probably damaging Het
Krt74 T G 15: 101,756,760 noncoding transcript Het
Lipe T C 7: 25,383,325 T801A probably benign Het
Lman1l A T 9: 57,611,866 F266I probably benign Het
Lrp1 A G 10: 127,593,839 V454A probably damaging Het
Lsm14a T C 7: 34,353,510 D338G probably damaging Het
Mctp1 T C 13: 77,024,783 silent Het
Mgea5 A G 19: 45,776,999 I123T probably damaging Het
Nlrp4a G A 7: 26,457,030 A727T probably benign Het
Nrgn T C 9: 37,546,048 S48G probably benign Het
Olfr1246 T C 2: 89,590,725 Y130C probably damaging Het
Olfr370 T C 8: 83,541,344 S67P probably damaging Het
Olfr564 A G 7: 102,803,993 S172G probably benign Het
Pdia6 A G 12: 17,278,593 E183G probably benign Het
Pign T A 1: 105,589,315 I529F probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Samm50 T G 15: 84,214,128 I456S probably benign Het
Sesn1 A G 10: 41,811,271 R84G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Spag17 G T 3: 100,056,166 D1067Y probably damaging Het
Sptan1 C T 2: 29,990,993 Q425* probably null Het
Srrm4 T A 5: 116,591,359 I36F unknown Het
Tas1r2 A T 4: 139,659,796 S189C probably damaging Het
Tep1 A G 14: 50,853,605 V690A possibly damaging Het
Trmo T C 4: 46,382,073 K348R probably benign Het
Trmu T A 15: 85,882,698 M36K probably damaging Het
Ubr4 A G 4: 139,452,648 T3380A possibly damaging Het
Unc79 A C 12: 103,171,572 T2425P probably damaging Het
Vmn2r12 G A 5: 109,092,800 T149I probably benign Het
Vwa3a A C 7: 120,790,143 K68T probably damaging Het
Yif1a T C 19: 5,088,750 probably null Het
Zbtb44 A T 9: 31,054,052 T253S probably damaging Het
Zdhhc3 T C 9: 123,100,345 Y75C probably damaging Het
Zfp189 T A 4: 49,530,153 F419I probably benign Het
Zfp663 T C 2: 165,353,009 D430G probably benign Het
Zfp709 T G 8: 71,889,991 probably null Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
murre UTSW 6 118549637 critical splice donor site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0344:Ankrd26 UTSW 6 118507637 critical splice donor site probably null
R0828:Ankrd26 UTSW 6 118533473 splice site probably benign
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2164:Ankrd26 UTSW 6 118525791 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3107:Ankrd26 UTSW 6 118556243 missense probably benign 0.01
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6181:Ankrd26 UTSW 6 118548877 missense probably benign 0.15
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
R7348:Ankrd26 UTSW 6 118508564 missense probably damaging 1.00
R7414:Ankrd26 UTSW 6 118508780 missense possibly damaging 0.60
R7789:Ankrd26 UTSW 6 118527798 missense probably damaging 0.98
R7789:Ankrd26 UTSW 6 118527799 missense possibly damaging 0.82
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Z1177:Ankrd26 UTSW 6 118523532 missense possibly damaging 0.77
Z1177:Ankrd26 UTSW 6 118523595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCAAAGGAGACAGTGTGGTAC -3'
(R):5'- CTGCATAAATCGATGGTTGGC -3'

Sequencing Primer
(F):5'- GGAGACAGTGTGGTACCTACC -3'
(R):5'- CTGCATAAATCGATGGTTGGCTTACC -3'
Posted On2016-11-08