Incidental Mutation 'R5639:Nlrp4a'
ID440541
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission 043288-MU
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5639 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26457030 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 727 (A727T)
Ref Sequence ENSEMBL: ENSMUSP00000112441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: A727T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: A727T

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: A727T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: A727T

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: A727T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,043,234 Y322H probably benign Het
Aldh1a1 C A 19: 20,623,422 T201K probably damaging Het
Ankrd26 T C 6: 118,539,724 E493G possibly damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Bicc1 A T 10: 70,940,520 V701E probably damaging Het
Car11 T A 7: 45,702,621 probably null Het
Celsr1 C G 15: 86,030,767 V1002L probably damaging Het
Clpx T A 9: 65,329,830 S597T probably benign Het
Cyr61 A C 3: 145,648,697 V153G probably damaging Het
Dmpk A G 7: 19,092,600 M545V probably benign Het
Dnah7c C G 1: 46,739,668 D3139E probably benign Het
Drd5 T A 5: 38,319,835 V57D possibly damaging Het
Epc2 A G 2: 49,451,891 N29S possibly damaging Het
Ercc3 T C 18: 32,265,714 V682A probably damaging Het
Fam186a T C 15: 99,947,050 K438E unknown Het
Farp1 T A 14: 121,275,382 I764N probably damaging Het
Flvcr2 A T 12: 85,747,476 I209F probably benign Het
Fndc3b C T 3: 27,426,153 V1065M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gp6 C A 7: 4,394,131 D102Y probably damaging Het
Gpc5 T C 14: 115,092,747 L114P probably benign Het
Kcnq3 T A 15: 65,997,750 E613V probably damaging Het
Krt74 T G 15: 101,756,760 noncoding transcript Het
Lipe T C 7: 25,383,325 T801A probably benign Het
Lman1l A T 9: 57,611,866 F266I probably benign Het
Lrp1 A G 10: 127,593,839 V454A probably damaging Het
Lsm14a T C 7: 34,353,510 D338G probably damaging Het
Mctp1 T C 13: 77,024,783 silent Het
Mgea5 A G 19: 45,776,999 I123T probably damaging Het
Nrgn T C 9: 37,546,048 S48G probably benign Het
Olfr1246 T C 2: 89,590,725 Y130C probably damaging Het
Olfr370 T C 8: 83,541,344 S67P probably damaging Het
Olfr564 A G 7: 102,803,993 S172G probably benign Het
Pdia6 A G 12: 17,278,593 E183G probably benign Het
Pign T A 1: 105,589,315 I529F probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Samm50 T G 15: 84,214,128 I456S probably benign Het
Sesn1 A G 10: 41,811,271 R84G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Spag17 G T 3: 100,056,166 D1067Y probably damaging Het
Sptan1 C T 2: 29,990,993 Q425* probably null Het
Srrm4 T A 5: 116,591,359 I36F unknown Het
Tas1r2 A T 4: 139,659,796 S189C probably damaging Het
Tep1 A G 14: 50,853,605 V690A possibly damaging Het
Trmo T C 4: 46,382,073 K348R probably benign Het
Trmu T A 15: 85,882,698 M36K probably damaging Het
Ubr4 A G 4: 139,452,648 T3380A possibly damaging Het
Unc79 A C 12: 103,171,572 T2425P probably damaging Het
Vmn2r12 G A 5: 109,092,800 T149I probably benign Het
Vwa3a A C 7: 120,790,143 K68T probably damaging Het
Yif1a T C 19: 5,088,750 probably null Het
Zbtb44 A T 9: 31,054,052 T253S probably damaging Het
Zdhhc3 T C 9: 123,100,345 Y75C probably damaging Het
Zfp189 T A 4: 49,530,153 F419I probably benign Het
Zfp663 T C 2: 165,353,009 D430G probably benign Het
Zfp709 T G 8: 71,889,991 probably null Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATTCCATTTCAGCAAGCTTAAAC -3'
(R):5'- CACAGTCTCTACAGTGTACCCC -3'

Sequencing Primer
(F):5'- CATTGCTCAGAGGGTTATAAGCACC -3'
(R):5'- CCTCCCAAGGCTACTTACACTAAGTG -3'
Posted On2016-11-08