Incidental Mutation 'R5639:Olfr370'
ID440547
Institutional Source Beutler Lab
Gene Symbol Olfr370
Ensembl Gene ENSMUSG00000047286
Gene Nameolfactory receptor 370
SynonymsGA_x6K02T2NUPS-11609807-11610751, MOR267-16
MMRRC Submission 043288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5639 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83535780-83545227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83541344 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000149251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058609] [ENSMUST00000209408] [ENSMUST00000214156]
Predicted Effect probably damaging
Transcript: ENSMUST00000058609
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055435
Gene: ENSMUSG00000047286
AA Change: S67P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-44 PFAM
Pfam:7tm_1 41 290 6.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209408
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214156
AA Change: S67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,043,234 Y322H probably benign Het
Aldh1a1 C A 19: 20,623,422 T201K probably damaging Het
Ankrd26 T C 6: 118,539,724 E493G possibly damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Bicc1 A T 10: 70,940,520 V701E probably damaging Het
Car11 T A 7: 45,702,621 probably null Het
Celsr1 C G 15: 86,030,767 V1002L probably damaging Het
Clpx T A 9: 65,329,830 S597T probably benign Het
Cyr61 A C 3: 145,648,697 V153G probably damaging Het
Dmpk A G 7: 19,092,600 M545V probably benign Het
Dnah7c C G 1: 46,739,668 D3139E probably benign Het
Drd5 T A 5: 38,319,835 V57D possibly damaging Het
Epc2 A G 2: 49,451,891 N29S possibly damaging Het
Ercc3 T C 18: 32,265,714 V682A probably damaging Het
Fam186a T C 15: 99,947,050 K438E unknown Het
Farp1 T A 14: 121,275,382 I764N probably damaging Het
Flvcr2 A T 12: 85,747,476 I209F probably benign Het
Fndc3b C T 3: 27,426,153 V1065M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gp6 C A 7: 4,394,131 D102Y probably damaging Het
Gpc5 T C 14: 115,092,747 L114P probably benign Het
Kcnq3 T A 15: 65,997,750 E613V probably damaging Het
Krt74 T G 15: 101,756,760 noncoding transcript Het
Lipe T C 7: 25,383,325 T801A probably benign Het
Lman1l A T 9: 57,611,866 F266I probably benign Het
Lrp1 A G 10: 127,593,839 V454A probably damaging Het
Lsm14a T C 7: 34,353,510 D338G probably damaging Het
Mctp1 T C 13: 77,024,783 silent Het
Mgea5 A G 19: 45,776,999 I123T probably damaging Het
Nlrp4a G A 7: 26,457,030 A727T probably benign Het
Nrgn T C 9: 37,546,048 S48G probably benign Het
Olfr1246 T C 2: 89,590,725 Y130C probably damaging Het
Olfr564 A G 7: 102,803,993 S172G probably benign Het
Pdia6 A G 12: 17,278,593 E183G probably benign Het
Pign T A 1: 105,589,315 I529F probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Samm50 T G 15: 84,214,128 I456S probably benign Het
Sesn1 A G 10: 41,811,271 R84G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Spag17 G T 3: 100,056,166 D1067Y probably damaging Het
Sptan1 C T 2: 29,990,993 Q425* probably null Het
Srrm4 T A 5: 116,591,359 I36F unknown Het
Tas1r2 A T 4: 139,659,796 S189C probably damaging Het
Tep1 A G 14: 50,853,605 V690A possibly damaging Het
Trmo T C 4: 46,382,073 K348R probably benign Het
Trmu T A 15: 85,882,698 M36K probably damaging Het
Ubr4 A G 4: 139,452,648 T3380A possibly damaging Het
Unc79 A C 12: 103,171,572 T2425P probably damaging Het
Vmn2r12 G A 5: 109,092,800 T149I probably benign Het
Vwa3a A C 7: 120,790,143 K68T probably damaging Het
Yif1a T C 19: 5,088,750 probably null Het
Zbtb44 A T 9: 31,054,052 T253S probably damaging Het
Zdhhc3 T C 9: 123,100,345 Y75C probably damaging Het
Zfp189 T A 4: 49,530,153 F419I probably benign Het
Zfp663 T C 2: 165,353,009 D430G probably benign Het
Zfp709 T G 8: 71,889,991 probably null Het
Other mutations in Olfr370
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr370 APN 8 83541618 missense probably benign 0.00
IGL02481:Olfr370 APN 8 83541386 missense possibly damaging 0.70
IGL02499:Olfr370 APN 8 83541183 missense possibly damaging 0.83
IGL02832:Olfr370 APN 8 83541471 missense probably damaging 1.00
R0315:Olfr370 UTSW 8 83541372 missense possibly damaging 0.90
R0330:Olfr370 UTSW 8 83541513 missense probably damaging 1.00
R1737:Olfr370 UTSW 8 83541416 missense probably benign 0.05
R1973:Olfr370 UTSW 8 83541792 missense probably benign 0.00
R2157:Olfr370 UTSW 8 83541621 missense probably benign 0.00
R4687:Olfr370 UTSW 8 83541860 missense probably damaging 1.00
R6150:Olfr370 UTSW 8 83541153 missense probably benign 0.02
R6590:Olfr370 UTSW 8 83541275 missense probably benign 0.08
R6682:Olfr370 UTSW 8 83541558 missense probably benign 0.00
R6690:Olfr370 UTSW 8 83541275 missense probably benign 0.08
R7846:Olfr370 UTSW 8 83541897 missense probably damaging 1.00
R7886:Olfr370 UTSW 8 83541947 missense possibly damaging 0.95
R7929:Olfr370 UTSW 8 83541897 missense probably damaging 1.00
R7969:Olfr370 UTSW 8 83541947 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATCTGGGGCTGATCTCTGATG -3'
(R):5'- ATCGATCATAACCCATGGCTG -3'

Sequencing Primer
(F):5'- CCTCCATGGAGTGTGTAAATGACAC -3'
(R):5'- TAACCCATGGCTGCCAGC -3'
Posted On2016-11-08