Mutagenetix > Incidental Mutations

Incidental Mutation 'R5639:Clpx'

440552

Institutional Source

Beutler Lab

Gene Symbol

Clpx

Ensembl Gene

ENSMUSG00000015357

Gene Name

caseinolytic mitochondrial matrix peptidase chaperone subunit

Synonyms

MMRRC Submission

043288-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5639 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65294260-65330658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65329830 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 597 (S597T)

Ref Sequence

ENSEMBL: ENSMUSP00000109455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824]

Predicted Effect

probably benign
Transcript: ENSMUST00000015501
AA Change: S611T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: S611T

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
PDB:4I9K\|B	173	209	6e-7	PDB
low complexity region	259	268	N/A	INTRINSIC
AAA	286	437	1.64e-12	SMART
low complexity region	452	458	N/A	INTRINSIC
ClpB_D2-small	510	604	1.16e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113824
AA Change: S597T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: S597T

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	81	101	N/A	INTRINSIC
low complexity region	165	172	N/A	INTRINSIC
low complexity region	245	254	N/A	INTRINSIC
AAA	272	423	1.64e-12	SMART
low complexity region	438	444	N/A	INTRINSIC
ClpB_D2-small	496	590	1.16e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214251

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	T	C	8: 111,043,234	Y322H	probably benign	Het
Aldh1a1	C	A	19: 20,623,422	T201K	probably damaging	Het
Ankrd26	T	C	6: 118,539,724	E493G	possibly damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Bicc1	A	T	10: 70,940,520	V701E	probably damaging	Het
Car11	T	A	7: 45,702,621		probably null	Het
Celsr1	C	G	15: 86,030,767	V1002L	probably damaging	Het
Cyr61	A	C	3: 145,648,697	V153G	probably damaging	Het
Dmpk	A	G	7: 19,092,600	M545V	probably benign	Het
Dnah7c	C	G	1: 46,739,668	D3139E	probably benign	Het
Drd5	T	A	5: 38,319,835	V57D	possibly damaging	Het
Epc2	A	G	2: 49,451,891	N29S	possibly damaging	Het
Ercc3	T	C	18: 32,265,714	V682A	probably damaging	Het
Fam186a	T	C	15: 99,947,050	K438E	unknown	Het
Farp1	T	A	14: 121,275,382	I764N	probably damaging	Het
Flvcr2	A	T	12: 85,747,476	I209F	probably benign	Het
Fndc3b	C	T	3: 27,426,153	V1065M	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gp6	C	A	7: 4,394,131	D102Y	probably damaging	Het
Gpc5	T	C	14: 115,092,747	L114P	probably benign	Het
Kcnq3	T	A	15: 65,997,750	E613V	probably damaging	Het
Krt74	T	G	15: 101,756,760		noncoding transcript	Het
Lipe	T	C	7: 25,383,325	T801A	probably benign	Het
Lman1l	A	T	9: 57,611,866	F266I	probably benign	Het
Lrp1	A	G	10: 127,593,839	V454A	probably damaging	Het
Lsm14a	T	C	7: 34,353,510	D338G	probably damaging	Het
Mctp1	T	C	13: 77,024,783		silent	Het
Mgea5	A	G	19: 45,776,999	I123T	probably damaging	Het
Nlrp4a	G	A	7: 26,457,030	A727T	probably benign	Het
Nrgn	T	C	9: 37,546,048	S48G	probably benign	Het
Olfr1246	T	C	2: 89,590,725	Y130C	probably damaging	Het
Olfr370	T	C	8: 83,541,344	S67P	probably damaging	Het
Olfr564	A	G	7: 102,803,993	S172G	probably benign	Het
Pdia6	A	G	12: 17,278,593	E183G	probably benign	Het
Pign	T	A	1: 105,589,315	I529F	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Samm50	T	G	15: 84,214,128	I456S	probably benign	Het
Sesn1	A	G	10: 41,811,271	R84G	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Spag17	G	T	3: 100,056,166	D1067Y	probably damaging	Het
Sptan1	C	T	2: 29,990,993	Q425*	probably null	Het
Srrm4	T	A	5: 116,591,359	I36F	unknown	Het
Tas1r2	A	T	4: 139,659,796	S189C	probably damaging	Het
Tep1	A	G	14: 50,853,605	V690A	possibly damaging	Het
Trmo	T	C	4: 46,382,073	K348R	probably benign	Het
Trmu	T	A	15: 85,882,698	M36K	probably damaging	Het
Ubr4	A	G	4: 139,452,648	T3380A	possibly damaging	Het
Unc79	A	C	12: 103,171,572	T2425P	probably damaging	Het
Vmn2r12	G	A	5: 109,092,800	T149I	probably benign	Het
Vwa3a	A	C	7: 120,790,143	K68T	probably damaging	Het
Yif1a	T	C	19: 5,088,750		probably null	Het
Zbtb44	A	T	9: 31,054,052	T253S	probably damaging	Het
Zdhhc3	T	C	9: 123,100,345	Y75C	probably damaging	Het
Zfp189	T	A	4: 49,530,153	F419I	probably benign	Het
Zfp663	T	C	2: 165,353,009	D430G	probably benign	Het
Zfp709	T	G	8: 71,889,991		probably null	Het

Other mutations in Clpx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Clpx	APN	9	65324270	missense	probably damaging	1.00
IGL01394:Clpx	APN	9	65310213	missense	probably damaging	1.00
IGL01395:Clpx	APN	9	65301851	missense	probably benign	0.00
IGL01521:Clpx	APN	9	65318744	missense	probably damaging	1.00
IGL02141:Clpx	APN	9	65312118	splice site	probably null
IGL02512:Clpx	APN	9	65310251	missense	probably benign
IGL03008:Clpx	APN	9	65322775	missense	possibly damaging	0.76
IGL03146:Clpx	APN	9	65326830	missense	probably benign	0.01
IGL03152:Clpx	APN	9	65310176	missense	possibly damaging	0.56
IGL03309:Clpx	APN	9	65322692	missense	probably damaging	1.00
kneehigh	UTSW	9	65301879	nonsense	probably null
locust	UTSW	9	65324301	critical splice donor site	probably null
IGL02837:Clpx	UTSW	9	65324259	missense	probably damaging	1.00
R0167:Clpx	UTSW	9	65316737	missense	possibly damaging	0.53
R0399:Clpx	UTSW	9	65322769	missense	probably benign	0.03
R0666:Clpx	UTSW	9	65310225	missense	probably damaging	1.00
R1386:Clpx	UTSW	9	65326888	missense	probably null	0.88
R1594:Clpx	UTSW	9	65324270	missense	probably damaging	0.99
R2038:Clpx	UTSW	9	65317493	missense	probably damaging	1.00
R4131:Clpx	UTSW	9	65316655	missense	possibly damaging	0.64
R4715:Clpx	UTSW	9	65312114	missense	possibly damaging	0.92
R5107:Clpx	UTSW	9	65308539	missense	possibly damaging	0.93
R5248:Clpx	UTSW	9	65320850	missense	probably damaging	1.00
R5520:Clpx	UTSW	9	65317448	nonsense	probably null
R5718:Clpx	UTSW	9	65299964	missense	probably benign
R6109:Clpx	UTSW	9	65299952	missense	probably benign	0.02
R6172:Clpx	UTSW	9	65301879	nonsense	probably null
R6173:Clpx	UTSW	9	65301879	nonsense	probably null
R6748:Clpx	UTSW	9	65310159	missense	probably benign	0.00
R7287:Clpx	UTSW	9	65300013	nonsense	probably null
R7409:Clpx	UTSW	9	65324247	missense	possibly damaging	0.94
R7806:Clpx	UTSW	9	65299931	missense	probably benign
R7814:Clpx	UTSW	9	65324301	critical splice donor site	probably null
R8212:Clpx	UTSW	9	65320891	missense	possibly damaging	0.46
R8753:Clpx	UTSW	9	65316676	missense	probably damaging	1.00
X0067:Clpx	UTSW	9	65316695	missense	possibly damaging	0.86
Z1177:Clpx	UTSW	9	65299997	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCTTTAGGCAAATCACTAGAC -3'
(R):5'- CATCTGCATTGCTTAAGAGAATTCC -3'

Sequencing Primer
(F):5'- CTTTAGGCAAATCACTAGACTCTTC -3'
(R):5'- GCTTTTGACCATGTATGATATCCGAG -3'

Posted On

2016-11-08